ID: 938536894

View in Genome Browser
Species Human (GRCh38)
Location 2:132255065-132255087
Sequence TTTCTTGGAAGCTGCCCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938536889_938536894 -4 Left 938536889 2:132255046-132255068 CCAAAAACCCAAAGACTGGTTTC No data
Right 938536894 2:132255065-132255087 TTTCTTGGAAGCTGCCCAGCGGG No data
938536884_938536894 7 Left 938536884 2:132255035-132255057 CCCCTCGGAACCCAAAAACCCAA No data
Right 938536894 2:132255065-132255087 TTTCTTGGAAGCTGCCCAGCGGG No data
938536885_938536894 6 Left 938536885 2:132255036-132255058 CCCTCGGAACCCAAAAACCCAAA No data
Right 938536894 2:132255065-132255087 TTTCTTGGAAGCTGCCCAGCGGG No data
938536886_938536894 5 Left 938536886 2:132255037-132255059 CCTCGGAACCCAAAAACCCAAAG No data
Right 938536894 2:132255065-132255087 TTTCTTGGAAGCTGCCCAGCGGG No data
938536888_938536894 -3 Left 938536888 2:132255045-132255067 CCCAAAAACCCAAAGACTGGTTT No data
Right 938536894 2:132255065-132255087 TTTCTTGGAAGCTGCCCAGCGGG No data
938536883_938536894 14 Left 938536883 2:132255028-132255050 CCATACTCCCCTCGGAACCCAAA No data
Right 938536894 2:132255065-132255087 TTTCTTGGAAGCTGCCCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938536894 Original CRISPR TTTCTTGGAAGCTGCCCAGC GGG Intronic
No off target data available for this crispr