ID: 938536896

View in Genome Browser
Species Human (GRCh38)
Location 2:132255072-132255094
Sequence GAAGCTGCCCAGCGGGTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938536888_938536896 4 Left 938536888 2:132255045-132255067 CCCAAAAACCCAAAGACTGGTTT No data
Right 938536896 2:132255072-132255094 GAAGCTGCCCAGCGGGTCATGGG No data
938536891_938536896 -4 Left 938536891 2:132255053-132255075 CCCAAAGACTGGTTTCTTGGAAG No data
Right 938536896 2:132255072-132255094 GAAGCTGCCCAGCGGGTCATGGG No data
938536892_938536896 -5 Left 938536892 2:132255054-132255076 CCAAAGACTGGTTTCTTGGAAGC No data
Right 938536896 2:132255072-132255094 GAAGCTGCCCAGCGGGTCATGGG No data
938536886_938536896 12 Left 938536886 2:132255037-132255059 CCTCGGAACCCAAAAACCCAAAG No data
Right 938536896 2:132255072-132255094 GAAGCTGCCCAGCGGGTCATGGG No data
938536884_938536896 14 Left 938536884 2:132255035-132255057 CCCCTCGGAACCCAAAAACCCAA No data
Right 938536896 2:132255072-132255094 GAAGCTGCCCAGCGGGTCATGGG No data
938536889_938536896 3 Left 938536889 2:132255046-132255068 CCAAAAACCCAAAGACTGGTTTC No data
Right 938536896 2:132255072-132255094 GAAGCTGCCCAGCGGGTCATGGG No data
938536885_938536896 13 Left 938536885 2:132255036-132255058 CCCTCGGAACCCAAAAACCCAAA No data
Right 938536896 2:132255072-132255094 GAAGCTGCCCAGCGGGTCATGGG No data
938536883_938536896 21 Left 938536883 2:132255028-132255050 CCATACTCCCCTCGGAACCCAAA No data
Right 938536896 2:132255072-132255094 GAAGCTGCCCAGCGGGTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938536896 Original CRISPR GAAGCTGCCCAGCGGGTCAT GGG Intronic