ID: 938537226

View in Genome Browser
Species Human (GRCh38)
Location 2:132256737-132256759
Sequence GGTCCCGAAGGCGCACGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938537210_938537226 20 Left 938537210 2:132256694-132256716 CCCTCCGGGTGTCCACCAGGCCC No data
Right 938537226 2:132256737-132256759 GGTCCCGAAGGCGCACGCCCGGG No data
938537212_938537226 16 Left 938537212 2:132256698-132256720 CCGGGTGTCCACCAGGCCCACTC No data
Right 938537226 2:132256737-132256759 GGTCCCGAAGGCGCACGCCCGGG No data
938537211_938537226 19 Left 938537211 2:132256695-132256717 CCTCCGGGTGTCCACCAGGCCCA No data
Right 938537226 2:132256737-132256759 GGTCCCGAAGGCGCACGCCCGGG No data
938537216_938537226 8 Left 938537216 2:132256706-132256728 CCACCAGGCCCACTCGGGGTGCC No data
Right 938537226 2:132256737-132256759 GGTCCCGAAGGCGCACGCCCGGG No data
938537219_938537226 -1 Left 938537219 2:132256715-132256737 CCACTCGGGGTGCCGCCGACCTG No data
Right 938537226 2:132256737-132256759 GGTCCCGAAGGCGCACGCCCGGG No data
938537206_938537226 27 Left 938537206 2:132256687-132256709 CCCCAAACCCTCCGGGTGTCCAC No data
Right 938537226 2:132256737-132256759 GGTCCCGAAGGCGCACGCCCGGG No data
938537217_938537226 5 Left 938537217 2:132256709-132256731 CCAGGCCCACTCGGGGTGCCGCC No data
Right 938537226 2:132256737-132256759 GGTCCCGAAGGCGCACGCCCGGG No data
938537218_938537226 0 Left 938537218 2:132256714-132256736 CCCACTCGGGGTGCCGCCGACCT No data
Right 938537226 2:132256737-132256759 GGTCCCGAAGGCGCACGCCCGGG No data
938537208_938537226 25 Left 938537208 2:132256689-132256711 CCAAACCCTCCGGGTGTCCACCA No data
Right 938537226 2:132256737-132256759 GGTCCCGAAGGCGCACGCCCGGG No data
938537207_938537226 26 Left 938537207 2:132256688-132256710 CCCAAACCCTCCGGGTGTCCACC No data
Right 938537226 2:132256737-132256759 GGTCCCGAAGGCGCACGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938537226 Original CRISPR GGTCCCGAAGGCGCACGCCC GGG Intronic