ID: 938537522

View in Genome Browser
Species Human (GRCh38)
Location 2:132257823-132257845
Sequence GGGATTGCGCGCACGCGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938537522_938537533 16 Left 938537522 2:132257823-132257845 CCGCTGCGCGTGCGCGCAATCCC No data
Right 938537533 2:132257862-132257884 CCACCAGCCTCCTTTCTCCCAGG 0: 1
1: 6
2: 5
3: 49
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938537522 Original CRISPR GGGATTGCGCGCACGCGCAG CGG (reversed) Intronic
No off target data available for this crispr