ID: 938539743

View in Genome Browser
Species Human (GRCh38)
Location 2:132276073-132276095
Sequence ATGTGACAGGAGAAGTGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938539739_938539743 18 Left 938539739 2:132276032-132276054 CCATTTTACAAGAGATGCTCATT No data
Right 938539743 2:132276073-132276095 ATGTGACAGGAGAAGTGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938539743 Original CRISPR ATGTGACAGGAGAAGTGTCA AGG Intergenic
No off target data available for this crispr