ID: 938540146

View in Genome Browser
Species Human (GRCh38)
Location 2:132278828-132278850
Sequence GGTGGGGCACACCCCACCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938540132_938540146 26 Left 938540132 2:132278779-132278801 CCCTTCCCAGGAGGAAGGGCACT No data
Right 938540146 2:132278828-132278850 GGTGGGGCACACCCCACCAAGGG No data
938540135_938540146 20 Left 938540135 2:132278785-132278807 CCAGGAGGAAGGGCACTCTGCAC No data
Right 938540146 2:132278828-132278850 GGTGGGGCACACCCCACCAAGGG No data
938540141_938540146 -7 Left 938540141 2:132278812-132278834 CCCAGTCCTAGCACATGGTGGGG No data
Right 938540146 2:132278828-132278850 GGTGGGGCACACCCCACCAAGGG No data
938540133_938540146 25 Left 938540133 2:132278780-132278802 CCTTCCCAGGAGGAAGGGCACTC No data
Right 938540146 2:132278828-132278850 GGTGGGGCACACCCCACCAAGGG No data
938540143_938540146 -8 Left 938540143 2:132278813-132278835 CCAGTCCTAGCACATGGTGGGGC No data
Right 938540146 2:132278828-132278850 GGTGGGGCACACCCCACCAAGGG No data
938540137_938540146 -2 Left 938540137 2:132278807-132278829 CCGGACCCAGTCCTAGCACATGG No data
Right 938540146 2:132278828-132278850 GGTGGGGCACACCCCACCAAGGG No data
938540134_938540146 21 Left 938540134 2:132278784-132278806 CCCAGGAGGAAGGGCACTCTGCA No data
Right 938540146 2:132278828-132278850 GGTGGGGCACACCCCACCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938540146 Original CRISPR GGTGGGGCACACCCCACCAA GGG Intergenic