ID: 938540501

View in Genome Browser
Species Human (GRCh38)
Location 2:132280499-132280521
Sequence GGGGCTTGGGGGGGGCAGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938540490_938540501 -6 Left 938540490 2:132280482-132280504 CCACAACAGGCATTCCTGGGGCT No data
Right 938540501 2:132280499-132280521 GGGGCTTGGGGGGGGCAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938540501 Original CRISPR GGGGCTTGGGGGGGGCAGCG GGG Intergenic
No off target data available for this crispr