ID: 938541305

View in Genome Browser
Species Human (GRCh38)
Location 2:132286211-132286233
Sequence GTGTGACAGTAGCAAGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938541302_938541305 7 Left 938541302 2:132286181-132286203 CCATTACAGGGGCCTCTTCTGCT No data
Right 938541305 2:132286211-132286233 GTGTGACAGTAGCAAGTAGATGG No data
938541304_938541305 -5 Left 938541304 2:132286193-132286215 CCTCTTCTGCTGGCAACAGTGTG No data
Right 938541305 2:132286211-132286233 GTGTGACAGTAGCAAGTAGATGG No data
938541298_938541305 25 Left 938541298 2:132286163-132286185 CCTGGGTGGTGATATCAGCCATT No data
Right 938541305 2:132286211-132286233 GTGTGACAGTAGCAAGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938541305 Original CRISPR GTGTGACAGTAGCAAGTAGA TGG Intergenic
No off target data available for this crispr