ID: 938541628

View in Genome Browser
Species Human (GRCh38)
Location 2:132288041-132288063
Sequence AGGGAGAAGCTGGGTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938541611_938541628 23 Left 938541611 2:132287995-132288017 CCCTGGTGAGGAGCTGCCCCTTG No data
Right 938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG No data
938541610_938541628 29 Left 938541610 2:132287989-132288011 CCACATCCCTGGTGAGGAGCTGC No data
Right 938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG No data
938541618_938541628 6 Left 938541618 2:132288012-132288034 CCCTTGGGTCTGAATTTCTGGGA No data
Right 938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG No data
938541616_938541628 7 Left 938541616 2:132288011-132288033 CCCCTTGGGTCTGAATTTCTGGG No data
Right 938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG No data
938541612_938541628 22 Left 938541612 2:132287996-132288018 CCTGGTGAGGAGCTGCCCCTTGG No data
Right 938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG No data
938541619_938541628 5 Left 938541619 2:132288013-132288035 CCTTGGGTCTGAATTTCTGGGAG No data
Right 938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938541628 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG Intergenic
No off target data available for this crispr