ID: 938560217 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:132465581-132465603 |
Sequence | AGATGTGTATGCCTCCTCCT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
938560217_938560223 | 18 | Left | 938560217 | 2:132465581-132465603 | CCTAGGAGGAGGCATACACATCT | No data | ||
Right | 938560223 | 2:132465622-132465644 | TGGAGTTGTCAAACATGCTAAGG | No data | ||||
938560217_938560220 | -2 | Left | 938560217 | 2:132465581-132465603 | CCTAGGAGGAGGCATACACATCT | No data | ||
Right | 938560220 | 2:132465602-132465624 | CTCCCTTGGCAGGTTTACAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
938560217 | Original CRISPR | AGATGTGTATGCCTCCTCCT AGG (reversed) | Intronic | ||