ID: 938560217

View in Genome Browser
Species Human (GRCh38)
Location 2:132465581-132465603
Sequence AGATGTGTATGCCTCCTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938560217_938560223 18 Left 938560217 2:132465581-132465603 CCTAGGAGGAGGCATACACATCT No data
Right 938560223 2:132465622-132465644 TGGAGTTGTCAAACATGCTAAGG No data
938560217_938560220 -2 Left 938560217 2:132465581-132465603 CCTAGGAGGAGGCATACACATCT No data
Right 938560220 2:132465602-132465624 CTCCCTTGGCAGGTTTACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938560217 Original CRISPR AGATGTGTATGCCTCCTCCT AGG (reversed) Intronic