ID: 938560221

View in Genome Browser
Species Human (GRCh38)
Location 2:132465604-132465626
Sequence CTCCACTGTAAACCTGCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938560221_938560223 -5 Left 938560221 2:132465604-132465626 CCCTTGGCAGGTTTACAGTGGAG No data
Right 938560223 2:132465622-132465644 TGGAGTTGTCAAACATGCTAAGG No data
938560221_938560224 14 Left 938560221 2:132465604-132465626 CCCTTGGCAGGTTTACAGTGGAG No data
Right 938560224 2:132465641-132465663 AAGGTTGTCACAGCGTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938560221 Original CRISPR CTCCACTGTAAACCTGCCAA GGG (reversed) Intronic
No off target data available for this crispr