ID: 938560223

View in Genome Browser
Species Human (GRCh38)
Location 2:132465622-132465644
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938560217_938560223 18 Left 938560217 2:132465581-132465603 CCTAGGAGGAGGCATACACATCT No data
Right 938560223 2:132465622-132465644 TGGAGTTGTCAAACATGCTAAGG No data
938560221_938560223 -5 Left 938560221 2:132465604-132465626 CCCTTGGCAGGTTTACAGTGGAG No data
Right 938560223 2:132465622-132465644 TGGAGTTGTCAAACATGCTAAGG No data
938560222_938560223 -6 Left 938560222 2:132465605-132465627 CCTTGGCAGGTTTACAGTGGAGT No data
Right 938560223 2:132465622-132465644 TGGAGTTGTCAAACATGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type