ID: 938560224

View in Genome Browser
Species Human (GRCh38)
Location 2:132465641-132465663
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938560222_938560224 13 Left 938560222 2:132465605-132465627 CCTTGGCAGGTTTACAGTGGAGT No data
Right 938560224 2:132465641-132465663 AAGGTTGTCACAGCGTTTGAAGG No data
938560221_938560224 14 Left 938560221 2:132465604-132465626 CCCTTGGCAGGTTTACAGTGGAG No data
Right 938560224 2:132465641-132465663 AAGGTTGTCACAGCGTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type