ID: 938566304

View in Genome Browser
Species Human (GRCh38)
Location 2:132522085-132522107
Sequence AGCCGGCGGGGCCACAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938566304_938566316 7 Left 938566304 2:132522085-132522107 CCTTCCCTGTGGCCCCGCCGGCT No data
Right 938566316 2:132522115-132522137 TTGGAGTCCCTATCTGTCAAAGG No data
938566304_938566319 25 Left 938566304 2:132522085-132522107 CCTTCCCTGTGGCCCCGCCGGCT No data
Right 938566319 2:132522133-132522155 AAAGGCCATCCTTAGCCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938566304 Original CRISPR AGCCGGCGGGGCCACAGGGA AGG (reversed) Intronic
No off target data available for this crispr