ID: 938569496

View in Genome Browser
Species Human (GRCh38)
Location 2:132549373-132549395
Sequence CTCTGAAGGAAACCTGTATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938569496_938569501 16 Left 938569496 2:132549373-132549395 CCATATACAGGTTTCCTTCAGAG No data
Right 938569501 2:132549412-132549434 ACTGTTTAACACGACTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938569496 Original CRISPR CTCTGAAGGAAACCTGTATA TGG (reversed) Intronic
No off target data available for this crispr