ID: 938569501

View in Genome Browser
Species Human (GRCh38)
Location 2:132549412-132549434
Sequence ACTGTTTAACACGACTGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938569496_938569501 16 Left 938569496 2:132549373-132549395 CCATATACAGGTTTCCTTCAGAG No data
Right 938569501 2:132549412-132549434 ACTGTTTAACACGACTGAAAAGG No data
938569494_938569501 30 Left 938569494 2:132549359-132549381 CCAAACTTTGCTCACCATATACA No data
Right 938569501 2:132549412-132549434 ACTGTTTAACACGACTGAAAAGG No data
938569497_938569501 2 Left 938569497 2:132549387-132549409 CCTTCAGAGTCCCAGTGTCCATA No data
Right 938569501 2:132549412-132549434 ACTGTTTAACACGACTGAAAAGG No data
938569499_938569501 -9 Left 938569499 2:132549398-132549420 CCAGTGTCCATATTACTGTTTAA No data
Right 938569501 2:132549412-132549434 ACTGTTTAACACGACTGAAAAGG No data
938569498_938569501 -8 Left 938569498 2:132549397-132549419 CCCAGTGTCCATATTACTGTTTA No data
Right 938569501 2:132549412-132549434 ACTGTTTAACACGACTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938569501 Original CRISPR ACTGTTTAACACGACTGAAA AGG Intronic
No off target data available for this crispr