ID: 938577219

View in Genome Browser
Species Human (GRCh38)
Location 2:132615959-132615981
Sequence AATCACTTGCTTAAAATAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938577219_938577221 3 Left 938577219 2:132615959-132615981 CCAGTTATTTTAAGCAAGTGATT No data
Right 938577221 2:132615985-132616007 TAACACAGATTAGGCAAGTATGG No data
938577219_938577222 16 Left 938577219 2:132615959-132615981 CCAGTTATTTTAAGCAAGTGATT No data
Right 938577222 2:132615998-132616020 GCAAGTATGGTGAGAGTCACAGG No data
938577219_938577220 -6 Left 938577219 2:132615959-132615981 CCAGTTATTTTAAGCAAGTGATT No data
Right 938577220 2:132615976-132615998 GTGATTCTTTAACACAGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938577219 Original CRISPR AATCACTTGCTTAAAATAAC TGG (reversed) Intronic
No off target data available for this crispr