ID: 938582930

View in Genome Browser
Species Human (GRCh38)
Location 2:132663608-132663630
Sequence CCTTTGCCAAAAATAGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938582925_938582930 24 Left 938582925 2:132663561-132663583 CCGCCGTGCCCAGCTTCATTTTA No data
Right 938582930 2:132663608-132663630 CCTTTGCCAAAAATAGAATGTGG No data
938582926_938582930 21 Left 938582926 2:132663564-132663586 CCGTGCCCAGCTTCATTTTAAAG No data
Right 938582930 2:132663608-132663630 CCTTTGCCAAAAATAGAATGTGG No data
938582928_938582930 15 Left 938582928 2:132663570-132663592 CCAGCTTCATTTTAAAGTTTTTT No data
Right 938582930 2:132663608-132663630 CCTTTGCCAAAAATAGAATGTGG No data
938582927_938582930 16 Left 938582927 2:132663569-132663591 CCCAGCTTCATTTTAAAGTTTTT No data
Right 938582930 2:132663608-132663630 CCTTTGCCAAAAATAGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938582930 Original CRISPR CCTTTGCCAAAAATAGAATG TGG Intronic
No off target data available for this crispr