ID: 938583690

View in Genome Browser
Species Human (GRCh38)
Location 2:132669778-132669800
Sequence GCGCAGGGCTGGCCCCGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 310}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938583679_938583690 3 Left 938583679 2:132669752-132669774 CCGCCAACTCCCGCTGGGCAGCC 0: 1
1: 0
2: 3
3: 20
4: 236
Right 938583690 2:132669778-132669800 GCGCAGGGCTGGCCCCGAGGTGG 0: 1
1: 0
2: 5
3: 34
4: 310
938583671_938583690 30 Left 938583671 2:132669725-132669747 CCTCGCGCCCCGGGGCACCAGTC 0: 1
1: 0
2: 0
3: 12
4: 120
Right 938583690 2:132669778-132669800 GCGCAGGGCTGGCCCCGAGGTGG 0: 1
1: 0
2: 5
3: 34
4: 310
938583680_938583690 0 Left 938583680 2:132669755-132669777 CCAACTCCCGCTGGGCAGCCCCA 0: 1
1: 0
2: 3
3: 25
4: 247
Right 938583690 2:132669778-132669800 GCGCAGGGCTGGCCCCGAGGTGG 0: 1
1: 0
2: 5
3: 34
4: 310
938583681_938583690 -6 Left 938583681 2:132669761-132669783 CCCGCTGGGCAGCCCCAGCGCAG 0: 1
1: 0
2: 3
3: 45
4: 379
Right 938583690 2:132669778-132669800 GCGCAGGGCTGGCCCCGAGGTGG 0: 1
1: 0
2: 5
3: 34
4: 310
938583676_938583690 13 Left 938583676 2:132669742-132669764 CCAGTCGCGGCCGCCAACTCCCG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 938583690 2:132669778-132669800 GCGCAGGGCTGGCCCCGAGGTGG 0: 1
1: 0
2: 5
3: 34
4: 310
938583673_938583690 23 Left 938583673 2:132669732-132669754 CCCCGGGGCACCAGTCGCGGCCG 0: 1
1: 0
2: 1
3: 3
4: 67
Right 938583690 2:132669778-132669800 GCGCAGGGCTGGCCCCGAGGTGG 0: 1
1: 0
2: 5
3: 34
4: 310
938583675_938583690 21 Left 938583675 2:132669734-132669756 CCGGGGCACCAGTCGCGGCCGCC 0: 1
1: 0
2: 0
3: 8
4: 140
Right 938583690 2:132669778-132669800 GCGCAGGGCTGGCCCCGAGGTGG 0: 1
1: 0
2: 5
3: 34
4: 310
938583682_938583690 -7 Left 938583682 2:132669762-132669784 CCGCTGGGCAGCCCCAGCGCAGG 0: 1
1: 0
2: 2
3: 51
4: 428
Right 938583690 2:132669778-132669800 GCGCAGGGCTGGCCCCGAGGTGG 0: 1
1: 0
2: 5
3: 34
4: 310
938583674_938583690 22 Left 938583674 2:132669733-132669755 CCCGGGGCACCAGTCGCGGCCGC 0: 1
1: 0
2: 0
3: 6
4: 118
Right 938583690 2:132669778-132669800 GCGCAGGGCTGGCCCCGAGGTGG 0: 1
1: 0
2: 5
3: 34
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938583690 Original CRISPR GCGCAGGGCTGGCCCCGAGG TGG Intronic
900144324 1:1151309-1151331 GCGCAGGAAGGGCCCCCAGGTGG - Intergenic
900178720 1:1302168-1302190 CTGCAGGGCTGGCCTCAAGGGGG + Intronic
900330911 1:2133982-2134004 GCCCAGGCCTGGCGCCCAGGTGG + Intronic
900724982 1:4210241-4210263 TCACAGGGCAGGCCCCCAGGTGG - Intergenic
900919693 1:5662455-5662477 GGGCAGGGCTGGCCACACGGGGG + Intergenic
900956918 1:5891960-5891982 GCCCAGGGTGGGCCCCAAGGGGG + Intronic
901130935 1:6962387-6962409 TCGGAGGGCGGGCCCAGAGGGGG - Intronic
901626650 1:10628765-10628787 CCGCAGGGCTGTCCCCCAGCAGG - Intronic
902435116 1:16393435-16393457 GGGCAGCGCCAGCCCCGAGGAGG + Exonic
902619912 1:17644739-17644761 AAGCAGGGCTGGGCCCGCGGTGG + Intronic
902810003 1:18882785-18882807 AGGCAGGGCTGGCCCGGAGCTGG - Intronic
903664037 1:24995885-24995907 GGGCAGGGCTGTCCACCAGGAGG + Intergenic
903886240 1:26542656-26542678 GAGCAGGGCAGGACCGGAGGGGG + Intronic
904003548 1:27351456-27351478 GCGCAGGACTGCCCCCGAGCGGG + Exonic
904312015 1:29635137-29635159 GCGCAGGGCGGGCCTGCAGGAGG - Intergenic
904461953 1:30685677-30685699 GCGGAAGGCTGGCCCTGAGCTGG + Intergenic
905052127 1:35060808-35060830 GCATAGGGCTGGGCCCTAGGAGG - Intronic
905212811 1:36385967-36385989 GCGGAGGGCGGGGCCCGGGGGGG - Intergenic
905345126 1:37306094-37306116 GCTCAGGGATGGGCCCCAGGGGG + Intergenic
905678017 1:39843488-39843510 GGGTGGGGCTGGCCCTGAGGTGG + Intronic
905884537 1:41484731-41484753 GGGCAGGGCTGGACCAGAAGGGG - Intergenic
906107764 1:43305007-43305029 GCGCAGGGGTGGCCCGGGCGGGG - Exonic
906256545 1:44355037-44355059 CTGCCGCGCTGGCCCCGAGGAGG - Exonic
906365533 1:45206439-45206461 GCCCAGCGGTGGCGCCGAGGGGG + Exonic
906802222 1:48748376-48748398 GCACAGGGCTGGCACTCAGGAGG - Intronic
907927921 1:58972084-58972106 GTGGAGAGCTGGCCCTGAGGAGG - Intergenic
908355050 1:63320387-63320409 GCGCAGCGCTGGCCCTGCCGCGG - Intergenic
909514266 1:76489758-76489780 GCTCAGGGCTGGACAAGAGGTGG + Intronic
912491695 1:110066032-110066054 GTGGAGGCCTGGCCCTGAGGAGG + Intronic
913217149 1:116630192-116630214 GGGCAGGGCTTGCCACCAGGGGG - Intronic
916107594 1:161442472-161442494 GCGCAGAGCTGGTCCCGGCGGGG - Intergenic
916109178 1:161449890-161449912 GCGCAGAGCTGGTCCCGGCGGGG - Intergenic
916110765 1:161457271-161457293 GCGCAGAGCTGGTCCCGGCGGGG - Intergenic
916112351 1:161464681-161464703 GCGCAGAGCTGGTCCCGGCGGGG - Intergenic
916113937 1:161472062-161472084 GCGCAGAGCTGGTCCCGGCGGGG - Intergenic
916854271 1:168734223-168734245 GTGACGTGCTGGCCCCGAGGAGG + Intergenic
921346165 1:214187522-214187544 GCTCAGGGCAGGCGCCAAGGGGG + Intergenic
922440617 1:225652925-225652947 GCGCGGAGCTGGTCCCCAGGCGG + Exonic
922481217 1:225941080-225941102 GCCCCTGGCTGGCCCCGGGGCGG - Exonic
922766501 1:228159012-228159034 GCCCAGGGCTGGCTCCGAGAAGG + Exonic
1064859792 10:19815609-19815631 GCGCTGGGCTGGGGTCGAGGGGG + Intergenic
1065189250 10:23195244-23195266 GCGCAGGCCTGGCCCAGGCGGGG + Intergenic
1068178122 10:53487719-53487741 GCGCAGGGCGGGGCCAGGGGTGG + Intergenic
1072253618 10:93600842-93600864 GCGCACGGCGGGCCGCGGGGAGG + Intronic
1072409076 10:95183889-95183911 GCGCAGTTCTCGCCCCGGGGCGG - Intergenic
1072654339 10:97319772-97319794 GCGCAGCGCAGGACCCCAGGGGG - Exonic
1073481937 10:103791537-103791559 CCTGAGGGCAGGCCCCGAGGCGG + Intronic
1076035616 10:127196559-127196581 GCGCCCGGCTGGCACCGAGGCGG + Intronic
1076168370 10:128300431-128300453 GCCCAGGCCTGGACCGGAGGGGG - Intergenic
1076721933 10:132396762-132396784 GCGCAGGGCTGGGCCCGGAGGGG + Intergenic
1076722081 10:132397150-132397172 GCGCGGGGCTGACCCGGCGGCGG + Exonic
1076738669 10:132469850-132469872 GCGCAGGGCTGCCTCAAAGGCGG + Intergenic
1076746739 10:132518300-132518322 GAGCAGGGCCGGCCCAGGGGAGG - Intergenic
1076919929 10:133446170-133446192 GGGCAGGGCTGGCCCGGACGGGG - Intergenic
1077009433 11:373642-373664 CCTCAGGGCTGGCCCTCAGGAGG - Intronic
1077141493 11:1026810-1026832 GCCTGGGGCTGGCCACGAGGTGG - Intronic
1077219973 11:1411488-1411510 GCCCAGGTCTGGCCCAGCGGTGG + Exonic
1077274880 11:1699983-1700005 GTGCAGGGCAGGCCCTGGGGAGG + Intergenic
1077305886 11:1868547-1868569 CTGCTGGGCTGGCCCTGAGGGGG + Intronic
1077505638 11:2928861-2928883 GCGCAGGGCTCGCCGGGACGCGG + Intronic
1077516549 11:3005483-3005505 GGGCAGGGCTGGCCCCGCAGTGG - Intronic
1078317074 11:10303200-10303222 GCGCAGGGCAGTCACCGAAGTGG - Intergenic
1079251703 11:18791886-18791908 GCGCAGGGCTGGCGGGGCGGGGG + Intronic
1080578510 11:33622357-33622379 CCACAGGGCTGGCCCTGAGGAGG + Intronic
1081854589 11:46295594-46295616 GTGCAGGGCTCGCGCGGAGGAGG - Intronic
1083487631 11:62993485-62993507 GGGCAGCACTGCCCCCGAGGAGG + Exonic
1083487931 11:62995364-62995386 GGGCAGAGCTGACCCAGAGGGGG + Intronic
1083551037 11:63590423-63590445 GCTCAGAGCTGGCCCCCAGCCGG + Intronic
1083630068 11:64090826-64090848 GTGCAGGGCTGGACCCGACTCGG - Intronic
1084273523 11:68040867-68040889 GCCCAGGGCTGCCCCGGGGGTGG - Intronic
1084420091 11:69056175-69056197 CGGCAGGGCTGGCGCTGAGGAGG - Intronic
1084696260 11:70757386-70757408 CCGCAGGGCTGGCCCCTAGCTGG + Intronic
1085455533 11:76663437-76663459 GCGCAGAGCTGGACCAGGGGAGG - Intronic
1087588457 11:100152914-100152936 GCTCAGGGCATGCCCTGAGGAGG - Intronic
1088792806 11:113241094-113241116 GGACAGGGCTGGCCCCAGGGCGG - Intronic
1089432739 11:118436808-118436830 GAGCAGGGCCGGCCCTGAAGAGG - Exonic
1089515293 11:119028210-119028232 GGGCTGGGCTGGCCCCCATGTGG - Exonic
1090274565 11:125410372-125410394 GAGAAAGGGTGGCCCCGAGGCGG + Intronic
1090913546 11:131142662-131142684 GCTCATGGCTGGCCCAGGGGTGG + Intergenic
1091795705 12:3296466-3296488 GACCTGGGCTGGCCCTGAGGAGG - Intergenic
1092195758 12:6548774-6548796 GCGCAAGGCTGCCGTCGAGGAGG - Exonic
1094607330 12:31959736-31959758 GCCCAGGGCCGGCCCCGGTGCGG - Intronic
1095975141 12:47935223-47935245 GCTCAGGGCTGGCCCTGGGTGGG - Intronic
1096398809 12:51288232-51288254 GCACAGGGATGGCCCCCAGGTGG - Intronic
1096464576 12:51841166-51841188 GGGCAGGGCTGTCCTCAAGGGGG + Intergenic
1096492093 12:52018618-52018640 AGGCAGGGTTGGCCCCAAGGAGG - Intergenic
1096628962 12:52913197-52913219 GGGCAGGGCTGGCCTTGGGGCGG - Intronic
1097190263 12:57216400-57216422 GCGCAGGGCAGGGGCCGAGGTGG - Intergenic
1102016034 12:109648608-109648630 CCCCAGGGCTGGACACGAGGGGG + Intergenic
1102498453 12:113335202-113335224 GGGCGGGGCGAGCCCCGAGGGGG - Intronic
1102638055 12:114341851-114341873 GCTCAGGGCTGGGCCAGAAGTGG - Intergenic
1104599924 12:130145917-130145939 GGTCAGGGCTGGCTCTGAGGAGG - Intergenic
1104766584 12:131333814-131333836 GGGCAGGGCTGGGCCCCTGGAGG + Intergenic
1104887035 12:132116910-132116932 GCGCAGGGCGGGCGCCGGGGCGG - Intronic
1104977780 12:132559981-132560003 GCGCGGCGCGGGCCCCGAGGCGG - Intronic
1106602724 13:31200758-31200780 GGGAAGGGCTGGCGCCGAGCTGG - Intronic
1108227507 13:48304101-48304123 GCGTAGGGCGGGCGCCAAGGCGG + Intronic
1112495368 13:99899814-99899836 GCGCAGGTTTGGCCCCTGGGTGG - Intergenic
1113464989 13:110506638-110506660 GCTCAGGGCTGGCCCGGAAGTGG + Intronic
1113726493 13:112606537-112606559 GCGCGGGTCCGGCCCTGAGGCGG + Intergenic
1113839370 13:113350078-113350100 GGGCAGGGCTGGCCTCCACGAGG - Intronic
1113886719 13:113664913-113664935 GGGCAGGGCTGGGCCCGTGCAGG + Intergenic
1113903397 13:113808404-113808426 GGGCAGGGCTTGTCCCTAGGGGG + Intronic
1113937438 13:114001868-114001890 CAGCAGGGCTGGCCCTGAGGGGG - Intronic
1118772612 14:68952247-68952269 GCCCAGGGCTGGCCTCCAGCAGG - Intronic
1118843384 14:69528553-69528575 GGGCAAGGCTGGCCCCCAAGTGG - Exonic
1119571940 14:75682385-75682407 CTGCATGGCTGGCACCGAGGAGG + Intronic
1119768141 14:77203684-77203706 GCTCGGGGCTGGCCCAGAGCAGG + Intronic
1121328076 14:93033447-93033469 CAGCAGGGCTGGCCCAGAGGAGG - Intronic
1121405433 14:93716753-93716775 ACACTGGGCTGGCCCCTAGGAGG + Intergenic
1122072249 14:99212486-99212508 GCGGAGGTCTGGCCCCCATGAGG - Intronic
1122083258 14:99281730-99281752 GCACAGGCCTGGCACAGAGGAGG + Intergenic
1122299801 14:100725197-100725219 GCTCTGGGCTGGCTCCAAGGAGG - Intergenic
1122494097 14:102139789-102139811 TCGCAGGGCTGGCCCGCGGGTGG + Intronic
1126454240 15:48843795-48843817 GCTGAGGGCTGGGCCCGAGAAGG - Intronic
1128313128 15:66644191-66644213 GCGCAGGGCTGGCACACAGTGGG - Intronic
1129243797 15:74267851-74267873 GTTCAGTGCTGGCCCGGAGGAGG - Intronic
1129607270 15:77031006-77031028 CCTCAGGGCTGGCCCGGAGTCGG + Intronic
1131074624 15:89487226-89487248 GCGCTGGGGGGGACCCGAGGTGG + Intronic
1131511620 15:93052257-93052279 GCGCAGGCGTGGCTGCGAGGTGG + Exonic
1132567547 16:630393-630415 GCTCAGGCCTGTCCCCAAGGCGG - Intronic
1133171665 16:3985832-3985854 GGCCAGGGGTGGCCCAGAGGGGG - Intronic
1133216802 16:4297525-4297547 GCACAGGCCTTGCCCCAAGGAGG - Intergenic
1133218821 16:4309573-4309595 GCACAGGGCTGGCCCTTAGAAGG - Intergenic
1136226568 16:28864087-28864109 AGACAGGGCTGGTCCCGAGGTGG + Intronic
1136384186 16:29912367-29912389 GGGGAGGGCTGGCCCTGAGGAGG - Intronic
1136682591 16:31976710-31976732 GCAGAGGGCTGGTCCCGCGGTGG - Intergenic
1138023238 16:53503208-53503230 GGGCAGGGCTGGCGCTGCGGCGG - Exonic
1138561276 16:57802276-57802298 GGGCAGGGCCGGCCCGGACGCGG + Intronic
1138582862 16:57952952-57952974 CCCCAGGGCAGGCCCCCAGGAGG + Intronic
1138584461 16:57960976-57960998 GTTGAGGCCTGGCCCCGAGGTGG - Intronic
1139468276 16:67165443-67165465 GCGCAGGACTGGCCGTGAGCGGG + Intronic
1139959581 16:70710017-70710039 GGGCAGGGCTGGCCTCCACGGGG - Intronic
1141132337 16:81444902-81444924 GCGGAGGGCGGGCGCCGGGGTGG - Intergenic
1141505939 16:84478750-84478772 GCCCAGGGCTGCTCCCGAGGGGG - Exonic
1141637752 16:85323703-85323725 GTCCAGGGCCGGCCCCAAGGGGG + Intergenic
1142110285 16:88327505-88327527 GCACAGGCCTGGCCCCTAGCTGG - Intergenic
1142188529 16:88706322-88706344 GCGCGGGCCTGGCCCCGGGATGG - Exonic
1142210802 16:88807642-88807664 GCTCAGGGGTGGCTCCAAGGAGG - Intronic
1142247643 16:88977159-88977181 GCGCAGGGCAGGGCCCCAGATGG - Exonic
1142324095 16:89402893-89402915 GCGCAGTGCTGGCCCTGATGGGG - Intronic
1142610849 17:1108711-1108733 GAGCTGGGCTGGCCTGGAGGGGG + Intronic
1142902105 17:3018476-3018498 CTGCAGGGCTGGCCCCGAGGAGG - Intronic
1143116851 17:4585863-4585885 GGGCTGGGCTGGACCCTAGGGGG + Intronic
1143202655 17:5123039-5123061 GCGCAGGGCTGGACCTGGGCTGG + Exonic
1143478463 17:7216079-7216101 GGGCAGGGCTGGCAGCGATGGGG - Intronic
1143513628 17:7408524-7408546 GCGCACGCCGGGCCACGAGGCGG - Exonic
1143790578 17:9292133-9292155 GTACAGGACTGGCCCAGAGGTGG + Intronic
1144791157 17:17860149-17860171 GGCCAGGGTTGGCCACGAGGAGG + Intronic
1145881648 17:28357062-28357084 GTACAGGGCTGGCCCTGGGGGGG - Intronic
1146687677 17:34852471-34852493 GGGCAGGGCTGGCCTCAGGGAGG - Intergenic
1147189117 17:38728798-38728820 GTGCAGGGCTGTGCCCGGGGTGG + Exonic
1147260382 17:39206661-39206683 TCCCAGGCCTGGCCCAGAGGAGG + Intergenic
1148632369 17:49121186-49121208 GCGCAGGCCTGGCTCAGAGTAGG - Intergenic
1149004935 17:51795726-51795748 GCTCAGGGCTGACCCCAGGGAGG + Intronic
1150292736 17:63990863-63990885 GGGCAGGCCTGGCCCCCAGGAGG - Intergenic
1151572976 17:74936355-74936377 GCGCAGGGCCGGCTCCGAGGAGG - Intronic
1151729955 17:75905137-75905159 GCCCATGGCTGGCCACCAGGGGG + Exonic
1151957588 17:77388123-77388145 GGGCAGGGCGGGCCCCTGGGAGG - Intronic
1152039592 17:77894322-77894344 GCTCAGGGCTGTCCCCGGAGGGG - Intergenic
1152069501 17:78127919-78127941 GCCCAGAGCTGGGTCCGAGGCGG + Intronic
1152637126 17:81434792-81434814 GCGCAGGGCTGGCCTGGAGAGGG + Intronic
1152701454 17:81821868-81821890 GCGCAGGGCTGGCCTCCCCGGGG - Intergenic
1153229413 18:2921980-2922002 GGGCGGGGCTGGGCCCAAGGTGG - Intronic
1156486936 18:37472309-37472331 GTGCAGGGCTGGCCGCAGGGAGG - Intronic
1157420782 18:47546122-47546144 GTGCAGGCCTGGCCCAGAAGAGG - Intergenic
1157489013 18:48109252-48109274 GGGCAGGGCTGGCCTGGATGGGG - Intronic
1157815572 18:50727523-50727545 GGGCAGGGCTGCCCCAGGGGTGG - Intronic
1160024095 18:75204694-75204716 GCGCAGGCCCGGCGCCGCGGTGG + Intronic
1160031024 18:75260128-75260150 GGGCAGGCCTGGCCCCGGAGGGG + Intronic
1161089331 19:2352296-2352318 GCGCAGGGCTGCTCCCTGGGCGG - Intronic
1161583039 19:5091151-5091173 CGGCCGGGCTGGCCCCGAGGTGG + Intronic
1161663297 19:5560285-5560307 GGGCACGGCTGTCCCCGTGGTGG + Intergenic
1161993204 19:7697091-7697113 GCGCAGGGCTGGTCTCAGGGAGG + Intronic
1162762676 19:12897697-12897719 TCCCAGGGCTGCCCCCGAGATGG + Exonic
1162872596 19:13597850-13597872 GTGCAAGCTTGGCCCCGAGGTGG - Intronic
1163118359 19:15201040-15201062 GCGCTGGGCCGGCCCCGGGGCGG - Intergenic
1163248282 19:16110808-16110830 GCCGAGGGCGGGCCCTGAGGAGG + Intergenic
1165845908 19:38817388-38817410 GGTCAGGGCTGGCCCAGGGGAGG + Intronic
1165936719 19:39393734-39393756 GCACAGGTCTGGCCCACAGGAGG - Intronic
1166329199 19:42069099-42069121 GCGCAGAGCAGGCCCCTAGTGGG + Intronic
1166677472 19:44748616-44748638 GCGTACGGGTGGCCCCGGGGGGG + Exonic
1166750980 19:45163920-45163942 GGGCAGGGCTGCCACGGAGGCGG + Exonic
1166948595 19:46412147-46412169 GCCGAGGGCGGGCCCCGGGGTGG - Exonic
1167125397 19:47545366-47545388 GCGGAGTGCTGGCCCGAAGGCGG - Exonic
1167258392 19:48443972-48443994 GCGCAGGCCACGGCCCGAGGGGG + Exonic
1167588142 19:50386687-50386709 GCACAGGGTGGGCCCCCAGGAGG - Intronic
1168336602 19:55600610-55600632 GCGCGGGGCGGGCCCTGCGGGGG - Intronic
1168702784 19:58451670-58451692 GCGCGGGTCGGGGCCCGAGGCGG + Exonic
925027118 2:618812-618834 GAGCAGGGCTACCCCAGAGGCGG - Intergenic
926130832 2:10302539-10302561 GCGCAGGGCTGGCCCCTCCCGGG + Intergenic
926684588 2:15689361-15689383 GAGCAAGGCTGGCCCCGAGGAGG - Intergenic
926707365 2:15846222-15846244 GCTCAGAGCTGGCCTCCAGGAGG + Intergenic
927516350 2:23674085-23674107 GGGCAGAGGTGGCACCGAGGAGG - Intronic
927650814 2:24912657-24912679 GCCCAGGGCTGGGCCAGGGGTGG - Intronic
929775548 2:44928980-44929002 GCGCAGGGAAGGCGGCGAGGGGG + Intergenic
929951170 2:46410624-46410646 GATCAGGGCTGGCCCTGAAGAGG - Intergenic
930700952 2:54457111-54457133 GCGCAGGGATGGGGCGGAGGTGG - Intronic
932391596 2:71395579-71395601 GCGCAGGACTGCTCCCAAGGCGG + Intronic
932463216 2:71896749-71896771 GAGCAGGGCTGGCGCTCAGGTGG - Intergenic
932568523 2:72924503-72924525 GCGCAGGGCAGGCCGCGACCGGG - Intronic
933728070 2:85437657-85437679 GCGCAGGGCAGGCCAGGGGGCGG + Intergenic
935820154 2:106886425-106886447 GAGCAGCGCTGGCCCCGGAGAGG - Exonic
937330588 2:121025883-121025905 GCTCAGGGCAGGCCCCAAGCAGG + Intergenic
938379338 2:130827860-130827882 GGGCAGGGCTGGCTGCAAGGAGG - Intergenic
938440889 2:131331301-131331323 GCGCAGGCCTGGCCTGGCGGAGG + Intronic
938583690 2:132669778-132669800 GCGCAGGGCTGGCCCCGAGGTGG + Intronic
942944407 2:181657120-181657142 GCGCAGGGCAGGGACCCAGGAGG + Intronic
944428042 2:199604024-199604046 GCACTGGGCTGGCCCCACGGAGG - Intergenic
947897738 2:233691381-233691403 GGACAGGGCTGGCCCCCATGGGG - Intronic
948454957 2:238100620-238100642 GCGCTGGGGTGGCCCCGTTGTGG - Exonic
948567793 2:238897548-238897570 GCACAAGGCTGGCCCTGAGCAGG - Intronic
1168904615 20:1393117-1393139 ACGCAGGGCTGGGCGTGAGGGGG - Exonic
1169195822 20:3681614-3681636 GGGCTGGGCTGCCCCCGAGGGGG + Intronic
1172603985 20:36202373-36202395 CCGAAGGGCTGGCCTGGAGGAGG - Intronic
1172756649 20:37289892-37289914 GCGCAGGGCTGCCCCAGGCGAGG - Intronic
1172764549 20:37344626-37344648 GCTCAGGGCGGGCCCCCAGCTGG - Intergenic
1173178977 20:40787438-40787460 CCGCTGGCCTGGCCCTGAGGGGG - Intergenic
1173223223 20:41146187-41146209 GCCCAGGCCTGGCACAGAGGAGG + Intronic
1173852414 20:46227480-46227502 GGGCAGGGCGGGGCCAGAGGCGG - Intronic
1174117124 20:48234090-48234112 GCAAGGGGCTGGCCCCTAGGAGG - Intergenic
1175268012 20:57714249-57714271 GGGCACGGCTGGCCCTGAGGAGG - Intergenic
1178103928 21:29298627-29298649 GGGCGGGGCGGGCCTCGAGGAGG - Intronic
1178327896 21:31660061-31660083 GCGCAGGCCCAGCCCCGCGGCGG - Intronic
1179044109 21:37829787-37829809 ACGCAGGGGTGCCCCCGAGATGG + Intronic
1179469957 21:41603744-41603766 CGGCAGGGCAGGCCTCGAGGGGG - Intergenic
1179888525 21:44324731-44324753 GCGCAGGGCAGGGCCCGGGCAGG + Intronic
1180091115 21:45534277-45534299 TCCCTGGGCTGGCCCTGAGGAGG - Intronic
1180818507 22:18808583-18808605 GGGCAGGGCTTGCCACCAGGGGG - Intergenic
1180961516 22:19764439-19764461 GCTCTGGGCTGTCCCCGAGGAGG + Intronic
1181079710 22:20405747-20405769 GCGCGGGGCGGGCGCCGGGGAGG + Exonic
1181204730 22:21243038-21243060 GGGCAGGGCTTGCCACCAGGGGG - Intergenic
1181581210 22:23829131-23829153 ACACAGGGCTGGCCCAGGGGAGG - Intronic
1182115880 22:27756115-27756137 CTGCAGGGCTGGGCCCGGGGAGG + Intronic
1183215032 22:36473939-36473961 GCACATGGCTGGCCCTCAGGGGG + Intronic
1183649514 22:39145847-39145869 GCGCAGGGCTCGCCCTGCTGCGG + Intronic
1183903298 22:41022029-41022051 GCCCAGGGCTGGGCCGGAGGGGG + Intergenic
1184468488 22:44682624-44682646 GCTCAGGCCTGGCCCATAGGAGG + Intronic
1184606738 22:45578695-45578717 GCACAGGGCTGGCCCCTTTGGGG - Intronic
1184710204 22:46245294-46245316 GGGAAGGGCTGGCCCCTGGGAGG - Intronic
1184871914 22:47245960-47245982 GCCCAGCACTGGCCCCTAGGAGG - Intergenic
1185314624 22:50173712-50173734 CAGCAGGGCTGGCTCCAAGGGGG + Intronic
1185388980 22:50548789-50548811 CCGCAGGGCTGCCGCCGTGGCGG - Exonic
1203222195 22_KI270731v1_random:52377-52399 GGGCAGGGCTTGCCACCAGGGGG + Intergenic
1203268636 22_KI270734v1_random:34437-34459 GGGCAGGGCTTGCCACCAGGGGG - Intergenic
953397034 3:42581757-42581779 GCGCAGGGCGGGCCCAGAGGTGG - Intronic
953871865 3:46633924-46633946 ACGCAGGGCTTGCCTCAAGGGGG + Intergenic
954200536 3:49021049-49021071 GCGCGGGGGTGTCCCCGAGGTGG - Exonic
954763876 3:52897212-52897234 GCGCAGGAGGGGCCCCCAGGGGG + Intronic
956129400 3:66039397-66039419 GCGCAGGGCAGGCAGGGAGGCGG - Intergenic
956689802 3:71865010-71865032 GCTCTGGGCTGGGCCCCAGGTGG + Intergenic
956889696 3:73600065-73600087 GAGCTGGGCTGGCACCGATGTGG + Intronic
959085631 3:101849115-101849137 GCGCAGGGCTGGGCCTGCAGAGG - Intronic
961448507 3:126992095-126992117 GCCCTGGGCTGGCCCCACGGTGG + Intronic
961742444 3:129041048-129041070 GTGCAGAGCTGGCCCCGGGGAGG + Intergenic
968426451 4:526582-526604 GTGCAGGGCTGACCCCGAGAGGG + Intronic
968448681 4:665059-665081 GCCCTGGCCTGGCCCCGAGGTGG - Intronic
968555901 4:1246355-1246377 GCCCAGGGGTGGCCAGGAGGTGG - Intronic
968904658 4:3445714-3445736 GCCCCGGGCTGGCCCCGCCGGGG - Intronic
969694533 4:8727215-8727237 GTGCAGGGCTGGCTCCTCGGGGG + Intergenic
978154165 4:105471266-105471288 GGTCAGGGCTGGCACCAAGGAGG + Intronic
983632144 4:169860135-169860157 GAGCACCGCTGGCCCAGAGGAGG + Intergenic
985765514 5:1777434-1777456 GCGCAGGGCTTTCCCCGGAGAGG - Intergenic
986018540 5:3779539-3779561 GAGGAGGGCTGGCCCGGAGTGGG + Intergenic
986327501 5:6687268-6687290 GTGCAGCGCTGGCTCCGAGCTGG - Intergenic
988866307 5:35338892-35338914 GCTCTGGGCTGGCCTCGTGGTGG - Intergenic
991587528 5:68215692-68215714 GCGCGGGGCCGGGCCGGAGGCGG + Intergenic
997013324 5:129904364-129904386 GCTCCGAGCTGGCCCGGAGGAGG - Intergenic
998139100 5:139689970-139689992 GCCCAGACCTGGCCCCCAGGAGG - Intergenic
1002180042 5:177426649-177426671 GCGCCGGGGTGGCCCCCGGGAGG + Intronic
1002372756 5:178768205-178768227 GCAGATGGCTGGCTCCGAGGAGG - Intergenic
1002435824 5:179230189-179230211 GGGCAGGGCTGGGCGTGAGGTGG + Intronic
1002708873 5:181182073-181182095 GTGAAGGCCTGGCCCCGAGAAGG - Intergenic
1002710273 5:181190940-181190962 GTGCAGGACTGGCCCCCTGGGGG - Intergenic
1002792207 6:444939-444961 GAGCAAGCCTGGCACCGAGGGGG + Intergenic
1002939161 6:1700759-1700781 TCCCAGTGCTGGGCCCGAGGAGG - Intronic
1003568582 6:7241007-7241029 GCCCAGGCCTGCTCCCGAGGAGG - Intronic
1003840382 6:10113392-10113414 GCGCAGGCCTGGCCCAGCGGGGG + Intronic
1007092026 6:39190586-39190608 GGGCAGGACTGACCCTGAGGAGG - Exonic
1007406456 6:41638593-41638615 GCGCATGGCGGGCCCCGCGCGGG + Exonic
1007727049 6:43922906-43922928 GCGCAGGGCTGGCCCATGGAGGG + Intergenic
1011084535 6:83524219-83524241 CCGAAGGGCTGGGCACGAGGAGG + Exonic
1011517114 6:88166516-88166538 CCCCAGGGCTGGCGCCGCGGCGG - Intergenic
1012996580 6:105981459-105981481 GCGCCGGGCCGGCCCCCAGAGGG - Intergenic
1017728233 6:157290958-157290980 CCACAGGGCTGGCACAGAGGAGG - Exonic
1018013601 6:159693336-159693358 GCGCGGGGCGGGGCCCGCGGGGG - Intronic
1018299538 6:162386589-162386611 GCACTGGGCTGGCCCTCAGGAGG + Intronic
1018969948 6:168520444-168520466 GTGCAGGGCTGGCCGGGACGGGG - Intronic
1019285835 7:222493-222515 GCCCAGGGCTGGCACTGAGAGGG + Intronic
1019410460 7:904520-904542 GCCCGGGGCTGCCCCCGGGGAGG - Intronic
1019448033 7:1081487-1081509 GCGCAGGGGTGGCGGCAAGGGGG + Intronic
1019618009 7:1975263-1975285 GGGAAGGCGTGGCCCCGAGGGGG - Intronic
1019722819 7:2583732-2583754 GCGGAGGGCGGGCACCGAGCTGG + Intronic
1019722831 7:2583763-2583785 GCGGAGGGCGGGCACCGAGCTGG + Intronic
1019722919 7:2583990-2584012 GCGGAGGGCGGGCACCGAGTGGG + Intronic
1019743677 7:2688157-2688179 GCGCGGGGCAGGGACCGAGGCGG - Intronic
1019983944 7:4641772-4641794 GCGCAGGGCGGGCCGCGAGCAGG - Intergenic
1020070501 7:5223883-5223905 GCACAGGGCGGGCCCACAGGTGG - Intronic
1020204542 7:6104897-6104919 GCGCGGCGCTGACCCGGAGGCGG + Exonic
1024933766 7:54691169-54691191 GGGAAGGGCAGGCCCCGAAGCGG - Intergenic
1025738956 7:64181636-64181658 GCGCCGGGCCGGCCCCGCGGTGG + Intronic
1026000313 7:66556157-66556179 GGGCTGGGCTGGCCCCGCCGTGG + Intergenic
1029458430 7:100682548-100682570 GCTCCGGGATGGCCCTGAGGGGG - Intronic
1029562003 7:101308931-101308953 GGGAAGGGCTGGGCCCCAGGCGG - Intergenic
1032931454 7:136677452-136677474 GGGGAGGGCTGCCCCCGAGTTGG + Intergenic
1034556981 7:151856366-151856388 ACGCTGGAGTGGCCCCGAGGCGG + Intronic
1035391547 7:158507909-158507931 GCGCAGGGCTGTCCCCTGGATGG - Intronic
1036258346 8:7222128-7222150 GCGCAGGCCTGGGCCCGGCGTGG - Intergenic
1036259407 8:7228272-7228294 GCGCAGGCCTGGGCCCGGCGTGG - Intergenic
1036307218 8:7611252-7611274 GCGCAGGCCTGGGCCCGGCGTGG + Intergenic
1036310400 8:7680724-7680746 GCGCAGGCCTGGGCCCGGCGTGG - Intergenic
1036358060 8:8059239-8059261 GCGCAGGCCTGGGCCCGGCGTGG + Intergenic
1036654963 8:10671977-10671999 GAGCAAGGCTGGCCCGGAGAAGG + Intronic
1036785501 8:11683272-11683294 GCGCAGAGCTGCCCCACAGGTGG + Intronic
1036892887 8:12607707-12607729 GCGCAGGCCTGGGCCCGGCGTGG - Intergenic
1037769352 8:21789592-21789614 GCGCGGGGCCGGCGCCGAAGGGG - Intronic
1037876524 8:22551554-22551576 CCGCAGGGCTGGCGTCGGGGAGG - Intronic
1037887254 8:22601600-22601622 GAGCAGAGTGGGCCCCGAGGAGG - Intronic
1039608728 8:38902323-38902345 GGGCAGGGCTGGCCCCGGGGAGG - Intronic
1049149355 8:141024351-141024373 GAGCAGGGCTGGCCCAGGGCTGG + Intergenic
1049408975 8:142464095-142464117 GGGCAGGGCCGGCCCGGTGGGGG - Exonic
1049473838 8:142787903-142787925 GGGCAGGGCCGGTTCCGAGGAGG + Intergenic
1049796612 8:144499983-144500005 GCCCAGGGCTGCCCCTCAGGAGG - Intronic
1049814561 8:144592275-144592297 GCTCAGTGCTGTCCCCCAGGAGG - Intronic
1049814576 8:144592324-144592346 GCTCAGTGCTGTCCCCCAGGAGG - Intronic
1049814591 8:144592373-144592395 GCTCAGTGCTGTCCCCCAGGAGG - Intronic
1049814607 8:144592422-144592444 GCTCAGTGCTGTCCCCCAGGAGG - Intronic
1049814622 8:144592471-144592493 GCTCAGTGCTGTCCCCCAGGAGG - Intronic
1049814636 8:144592519-144592541 GCTCAGTGCTGTCCCCCAGGAGG - Intronic
1049814650 8:144592567-144592589 GCTCAGTGCTGTCCCCCAGGAGG - Intronic
1049814665 8:144592616-144592638 GCTCAGTGCTGTCCCCCAGGAGG - Intronic
1052970949 9:34376913-34376935 CCCCAGGGCGGGACCCGAGGAGG - Intergenic
1056800399 9:89686894-89686916 AGCCTGGGCTGGCCCCGAGGGGG - Intergenic
1057819807 9:98322140-98322162 CCTCTGGGCTGGCCCAGAGGGGG + Intronic
1057844949 9:98515981-98516003 GCACTGGCCTGGCCCCTAGGTGG + Intronic
1060555318 9:124504833-124504855 GCGCGGGGCTGGCGGCGCGGGGG + Intronic
1061084977 9:128393300-128393322 GCGCAAGGCTGAACCCGAGCAGG + Intergenic
1061792587 9:133066468-133066490 GCCCAGGCCTGGCCTCCAGGAGG - Intronic
1061854923 9:133436814-133436836 TCGCAGGCCTGGCCAGGAGGAGG - Exonic
1061922239 9:133788585-133788607 GGGCAGGGCTCGCCCGGAGAGGG - Intronic
1062285404 9:135770524-135770546 GCACAGGGGTGGCCCTGGGGCGG + Intronic
1062291033 9:135794463-135794485 GTCCAGGGCTGGACCCGAAGTGG - Intergenic
1062484008 9:136765141-136765163 GGGCTGGGCTGGCCCTGGGGAGG + Intronic
1062647552 9:137556595-137556617 GGGCAGAGGTGGCTCCGAGGAGG + Intronic
1187915579 X:24149913-24149935 GCGCCGAGCAGGCCCCGAGGAGG + Intronic
1189332856 X:40153874-40153896 AGGCAGGGCTGGCCTCGTGGCGG + Intronic
1197226769 X:123961919-123961941 GCGCAGACCTTGCCCCGAAGGGG + Intronic
1198825304 X:140692483-140692505 GCGCATGGCAGGCCCCTAAGAGG + Intergenic
1200240140 X:154489069-154489091 TGGCAGGGCTGTCCCTGAGGAGG + Exonic
1200418289 Y:2935565-2935587 GCGCCGAACAGGCCCCGAGGAGG + Exonic