ID: 938583753

View in Genome Browser
Species Human (GRCh38)
Location 2:132670041-132670063
Sequence CGCTGCTGCCGCGGAGACGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 107}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938583743_938583753 19 Left 938583743 2:132669999-132670021 CCCGGCTGCAGCGGCTGTGGCTG 0: 1
1: 1
2: 7
3: 67
4: 569
Right 938583753 2:132670041-132670063 CGCTGCTGCCGCGGAGACGACGG 0: 1
1: 0
2: 0
3: 4
4: 107
938583749_938583753 -4 Left 938583749 2:132670022-132670044 CCGAGGCTGCTGGGGCCCGCGCT 0: 1
1: 0
2: 1
3: 16
4: 202
Right 938583753 2:132670041-132670063 CGCTGCTGCCGCGGAGACGACGG 0: 1
1: 0
2: 0
3: 4
4: 107
938583744_938583753 18 Left 938583744 2:132670000-132670022 CCGGCTGCAGCGGCTGTGGCTGC 0: 1
1: 1
2: 14
3: 75
4: 705
Right 938583753 2:132670041-132670063 CGCTGCTGCCGCGGAGACGACGG 0: 1
1: 0
2: 0
3: 4
4: 107
938583742_938583753 20 Left 938583742 2:132669998-132670020 CCCCGGCTGCAGCGGCTGTGGCT 0: 1
1: 0
2: 3
3: 43
4: 387
Right 938583753 2:132670041-132670063 CGCTGCTGCCGCGGAGACGACGG 0: 1
1: 0
2: 0
3: 4
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938583753 Original CRISPR CGCTGCTGCCGCGGAGACGA CGG Exonic