ID: 938583753

View in Genome Browser
Species Human (GRCh38)
Location 2:132670041-132670063
Sequence CGCTGCTGCCGCGGAGACGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 107}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938583744_938583753 18 Left 938583744 2:132670000-132670022 CCGGCTGCAGCGGCTGTGGCTGC 0: 1
1: 1
2: 14
3: 75
4: 705
Right 938583753 2:132670041-132670063 CGCTGCTGCCGCGGAGACGACGG 0: 1
1: 0
2: 0
3: 4
4: 107
938583743_938583753 19 Left 938583743 2:132669999-132670021 CCCGGCTGCAGCGGCTGTGGCTG 0: 1
1: 1
2: 7
3: 67
4: 569
Right 938583753 2:132670041-132670063 CGCTGCTGCCGCGGAGACGACGG 0: 1
1: 0
2: 0
3: 4
4: 107
938583749_938583753 -4 Left 938583749 2:132670022-132670044 CCGAGGCTGCTGGGGCCCGCGCT 0: 1
1: 0
2: 1
3: 16
4: 202
Right 938583753 2:132670041-132670063 CGCTGCTGCCGCGGAGACGACGG 0: 1
1: 0
2: 0
3: 4
4: 107
938583742_938583753 20 Left 938583742 2:132669998-132670020 CCCCGGCTGCAGCGGCTGTGGCT 0: 1
1: 0
2: 3
3: 43
4: 387
Right 938583753 2:132670041-132670063 CGCTGCTGCCGCGGAGACGACGG 0: 1
1: 0
2: 0
3: 4
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938583753 Original CRISPR CGCTGCTGCCGCGGAGACGA CGG Exonic
902878113 1:19353102-19353124 CGCTGCTGCCGGGGTGAGGCAGG + Intronic
907405696 1:54252205-54252227 CACTGCTGCCTCTGAGAGGAAGG - Intronic
915720194 1:157978983-157979005 CCCAGCTGCCGCGGGGTCGAGGG - Intergenic
1064244269 10:13656917-13656939 CGCGGCGGCGGCGGCGACGAGGG - Exonic
1065844956 10:29736408-29736430 CGCTGCAGCCCCGGAGATGCGGG + Intronic
1068228952 10:54144609-54144631 GGGTGCTGCCGCTGAGGCGATGG - Intronic
1072915524 10:99535456-99535478 CGCTGCTGCGGCGGCGGCGGCGG - Exonic
1076441893 10:130485884-130485906 CGCGGCAGCCGTGGAGAGGAAGG + Intergenic
1076869663 10:133187169-133187191 CGCTGCCTCCGCGGGGACGCTGG + Intronic
1096100916 12:48970046-48970068 CGGCGCTGCCGCGGAGGCTAGGG - Intronic
1097085821 12:56467529-56467551 CGCTTGTGCCTCGGAGATGAAGG + Intronic
1109543541 13:63811849-63811871 CGCTGCTCGCGGGGAGACGCCGG + Intergenic
1113853198 13:113429496-113429518 CGATTCAGCCGCGGAGAGGAAGG - Intronic
1118030405 14:61812818-61812840 CGCTCCGGCCGCGGAGGCCAGGG + Intergenic
1121112864 14:91324286-91324308 GGCTGCTGCCCCGGAGACCCAGG - Intronic
1127373278 15:58359796-58359818 CGCTGCTGCTGCTGTGACCAGGG + Intronic
1132392901 15:101451622-101451644 CGCTGCAGCTGCGGAGCGGACGG - Intronic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1133346149 16:5071896-5071918 CGCTGCTGCTGCTGGGAGGATGG + Exonic
1134164037 16:11915855-11915877 AGCTGCTGCCGCGGCGACGCCGG - Exonic
1140882034 16:79207148-79207170 AGCTGCTGCGGTGGAGATGAGGG - Intronic
1141087817 16:81109229-81109251 CTTTGATGCGGCGGAGACGATGG - Intergenic
1141876058 16:86825285-86825307 AGCTGCTGCCGTGGACAGGAGGG + Intergenic
1145077565 17:19868051-19868073 CGCTCCTGAGGCGGGGACGAAGG + Intergenic
1146332333 17:31937413-31937435 CGCTGCCGCCGCGGAGGAGGAGG - Exonic
1155392760 18:25352424-25352446 CGCAGCTGCGGCGGCGGCGACGG - Intergenic
1156985517 18:43346240-43346262 AGCTGCTGCCACTGAGATGAAGG + Intergenic
1160837635 19:1132191-1132213 GGCTGCTGCCGCGGTCATGAGGG - Intronic
1161073482 19:2273863-2273885 CGCTGCGGCCGGGCAGACGGCGG - Intronic
1162485915 19:10960660-10960682 GGCGGCGGCCGCGGTGACGATGG - Intergenic
1165721395 19:38082060-38082082 CGCTGCTGCTGCGGTGCCGAAGG - Exonic
1168643348 19:58044521-58044543 CGCGGCCGCCGCGGAGAAGGAGG + Intronic
925017883 2:545518-545540 CGCTGCTGCCGTGGAGCACACGG + Intergenic
925346509 2:3175645-3175667 CGCTGCTGCCCAGAAGAAGAAGG + Intergenic
927787188 2:25982153-25982175 CGCTGCTCCCGCGGCGACTGGGG - Exonic
928123223 2:28598893-28598915 CCCTGCTGCCCCTGTGACGAAGG + Intronic
928180471 2:29065060-29065082 CGCTGCTGCTGCCGAGAGAAAGG + Exonic
930951073 2:57145315-57145337 CCCTGCTGCCAGGGAGAGGAGGG - Intergenic
931487294 2:62705974-62705996 GGCTGCTGCTGCGGCGGCGACGG + Exonic
931487295 2:62705977-62705999 TGCTGCTGCGGCGGCGACGGAGG + Exonic
932496314 2:72147485-72147507 GGCTGCTGCGGCAGAGAGGAGGG + Intronic
938583753 2:132670041-132670063 CGCTGCTGCCGCGGAGACGACGG + Exonic
942276309 2:174326464-174326486 CGCAGCTGCGGAGGAGAGGAGGG + Intergenic
947021664 2:225684162-225684184 GGCTGCTGCCGAGGAGAGAATGG + Intergenic
947658805 2:231851248-231851270 CGGTGCTGCAGCGGAGGAGATGG + Intergenic
1168957547 20:1844913-1844935 TGCTGCTGCCGTAGAGAGGAAGG + Intergenic
1171292591 20:23990705-23990727 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
1179597876 21:42455266-42455288 AGCTGCTGACACGGAGACGGGGG - Intergenic
1180823459 22:18847539-18847561 CCCTGCTGCCACGCAGGCGAGGG + Exonic
1180823659 22:18848469-18848491 CCCTGCTGCCACGCAGGCGAGGG + Intronic
1181124081 22:20691567-20691589 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
1181189080 22:21126077-21126099 CCCTGCTGCCACGCAGGCGAGGG - Exonic
1181189283 22:21127007-21127029 CCCTGCTGCCACGCAGGCGAGGG - Exonic
1181209915 22:21283488-21283510 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
1181210120 22:21284418-21284440 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
1181399404 22:22642527-22642549 CCCTGCTGCCACGCAGGCGAGGG - Intergenic
1181649816 22:24252612-24252634 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
1181650013 22:24253541-24253563 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
1181707362 22:24657205-24657227 CCCTGCTGCCACGCAGGCGAGGG - Intergenic
1181707558 22:24658134-24658156 CCCTGCTGCCACGCAGGCGAGGG - Intergenic
1183523545 22:38310458-38310480 CGCTGCTGCTGCCGGGACGGTGG - Intronic
1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG + Exonic
1184472106 22:44702055-44702077 AGCTGCGGCCGCGGAGACGCCGG + Intronic
1203216828 22_KI270731v1_random:11015-11037 CCCTGCTGCCACGCAGGCGAGGG - Intergenic
1203217031 22_KI270731v1_random:11945-11967 CCCTGCTGCCACGCAGGCGAGGG - Intergenic
1203273600 22_KI270734v1_random:73445-73467 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
952908882 3:38165601-38165623 CGCTGCTGCTGCGGAGGCCGAGG + Exonic
961712129 3:128835862-128835884 CGCTGCTGCCCAGGAGTGGACGG + Intergenic
967263579 3:187670153-187670175 GGCTGCTGCCGCGGGGAAGCAGG - Exonic
968671778 4:1855989-1856011 CGCGGCCGCCGCGGAGAAGGAGG - Exonic
972686913 4:41360773-41360795 CGCTCCTGCGGCGGCGACGGCGG + Exonic
984462828 4:180058562-180058584 GGCTGCTGCCGGGGAGAAGCGGG - Intergenic
984667816 4:182448175-182448197 CGCGACTGCTGCGGGGACGAGGG + Intronic
985631643 5:1017169-1017191 CCCTGCTGCCCCGGGGACGTGGG + Intronic
991736168 5:69632564-69632586 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
991739298 5:69653852-69653874 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
991758900 5:69902579-69902601 CCCTGCTGCCACGCAGGCGAGGG - Intergenic
991788436 5:70215543-70215565 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
991790873 5:70233593-70233615 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
991812668 5:70488203-70488225 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
991815625 5:70508680-70508702 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
991818759 5:70529969-70529991 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
991838129 5:70777645-70777667 CCCTGCTGCCACGCAGGCGAGGG - Intergenic
991880883 5:71215907-71215929 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
991883320 5:71233928-71233950 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
994420647 5:99524531-99524553 CCCTGCTGCCACGCAGGCGAGGG - Intergenic
994486394 5:100389783-100389805 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
996518064 5:124395482-124395504 CCCTGCTGCCGCGGAGGCTGTGG - Intergenic
996862815 5:128084233-128084255 CGCTGCTGCGGCGGCGGCGGCGG + Exonic
1005549174 6:26897269-26897291 CCCTGCTGCCACGCAGGCGAGGG + Intergenic
1007378226 6:41470590-41470612 CGCTGGCGCCCCGGAGACGGCGG - Intergenic
1012895452 6:104941276-104941298 CGGTGCTGCCGCTAAGACGCGGG + Intergenic
1017672068 6:156778042-156778064 CGCTGCCGCCGCGGAGGAGGAGG - Exonic
1018686767 6:166309384-166309406 TGCTGCTGCCTCGGAGACTGAGG - Intergenic
1019327374 7:445111-445133 GGCTGCTGCCCCGGAGGCAAGGG - Intergenic
1022096533 7:27144902-27144924 CGCTGCTGTGGCGGCGACGCGGG + Intronic
1049337829 8:142095944-142095966 AGCTGCTGCTGCGGAGAGGGTGG + Intergenic
1049611380 8:143557404-143557426 AGCTGCTGCCGCTGTGGCGAAGG + Intronic
1049611382 8:143557425-143557447 GGATGCTGCCGCTGTGACGACGG + Intronic
1051079690 9:13279657-13279679 CGGGGCTGCCGCGGAGGCGGTGG + Intergenic
1052982063 9:34457368-34457390 CGCTGCTGGCGCGGAGGGAATGG - Intronic
1055354584 9:75424821-75424843 CGCTGCTGCTGTGGAGCCTATGG - Intergenic
1057173066 9:92975436-92975458 CGCAGCTGCCGAGGAGCCTAGGG - Intronic
1057489151 9:95508376-95508398 CGCCGCCGCCGCGGGGACGGAGG + Exonic
1061208596 9:129178049-129178071 CCATGCTCCCGCGGAGACGGCGG + Exonic
1062401575 9:136375110-136375132 CGCTGCTGCCACAGAGACAAAGG + Intergenic
1186638130 X:11427754-11427776 CGCTGCCGCTGCGGAGCCGGTGG + Intronic
1189244858 X:39555522-39555544 CCCTGCTGCCGAGGAGCCGTAGG + Intergenic
1192589129 X:72345344-72345366 CAATGCTGCCACGGAGAAGAGGG + Intronic
1196833048 X:119791346-119791368 CGCTGCGGCCGCGGATTCAAGGG - Intronic
1198005379 X:132488886-132488908 TGCTGCTGCCGCTGAGAGCAGGG - Intronic
1200746461 Y:6908420-6908442 CACTGCTGCCTGGGAGACAAAGG + Intergenic