ID: 938583929

View in Genome Browser
Species Human (GRCh38)
Location 2:132670746-132670768
Sequence TGCCCCCTCTTCCTCCGCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 129}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938583927_938583929 0 Left 938583927 2:132670723-132670745 CCGTAGGGTGTCCTGTGCAGCTG 0: 1
1: 0
2: 0
3: 11
4: 160
Right 938583929 2:132670746-132670768 TGCCCCCTCTTCCTCCGCGAAGG 0: 1
1: 0
2: 0
3: 10
4: 129
938583925_938583929 10 Left 938583925 2:132670713-132670735 CCCGCAGGCTCCGTAGGGTGTCC 0: 1
1: 0
2: 1
3: 4
4: 91
Right 938583929 2:132670746-132670768 TGCCCCCTCTTCCTCCGCGAAGG 0: 1
1: 0
2: 0
3: 10
4: 129
938583926_938583929 9 Left 938583926 2:132670714-132670736 CCGCAGGCTCCGTAGGGTGTCCT 0: 1
1: 0
2: 0
3: 3
4: 120
Right 938583929 2:132670746-132670768 TGCCCCCTCTTCCTCCGCGAAGG 0: 1
1: 0
2: 0
3: 10
4: 129
938583923_938583929 15 Left 938583923 2:132670708-132670730 CCACGCCCGCAGGCTCCGTAGGG 0: 1
1: 0
2: 1
3: 3
4: 93
Right 938583929 2:132670746-132670768 TGCCCCCTCTTCCTCCGCGAAGG 0: 1
1: 0
2: 0
3: 10
4: 129
938583920_938583929 27 Left 938583920 2:132670696-132670718 CCTGGCAAAGTTCCACGCCCGCA 0: 1
1: 0
2: 0
3: 4
4: 47
Right 938583929 2:132670746-132670768 TGCCCCCTCTTCCTCCGCGAAGG 0: 1
1: 0
2: 0
3: 10
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938583929 Original CRISPR TGCCCCCTCTTCCTCCGCGA AGG Intronic
902919372 1:19657098-19657120 AGCCCCCTCTTCCTCTGTGTGGG - Exonic
902978876 1:20109205-20109227 TGCCCCCTAGTCCTCCTCAAGGG + Intergenic
903748101 1:25602216-25602238 TGCCTCCTTTTCCTCCGCCCAGG - Intergenic
903875926 1:26472905-26472927 TGCCCCCTCCCCCATCGCGAGGG + Intronic
905092041 1:35437421-35437443 GGCCTCCTCTTCCTCAGAGAAGG - Intronic
905166075 1:36084172-36084194 GGCGCCCCCTTCCTCCGCGCTGG + Intronic
905788459 1:40776487-40776509 TGTCCCCTCTTCCTAAGCCATGG - Intergenic
906226026 1:44122164-44122186 GACCCCCTCTTCCTCTGCCACGG + Intronic
907460495 1:54602598-54602620 TGCCCCCTCTCCATCCCCCAGGG - Intronic
908056834 1:60296980-60297002 TGCCCCCTCCTCCTTCTCTAAGG - Intergenic
910147014 1:84091952-84091974 TGCCCACTCTACCTCCACTATGG - Intronic
911871766 1:103108281-103108303 TTCCCCCTCTCCCTCCCCAATGG - Exonic
912902101 1:113662351-113662373 TACCGCCTCTTCCTCTGCCATGG + Intronic
913450280 1:118988279-118988301 TGCCCCCTGTTCCTCGGGAAGGG - Intronic
918508601 1:185285143-185285165 TTCCTCCTCTTCCTCCCCGTGGG + Intronic
920071858 1:203307825-203307847 TGGCCTCTCTTCCTCCCCCAGGG - Exonic
1062845467 10:700062-700084 TGGCTCCTCTTCTTCCTCGAAGG - Intergenic
1064123447 10:12638833-12638855 TTCCCCATCTTCCTCTGGGAGGG + Intronic
1065092909 10:22252704-22252726 CGCCCTCTCCTCCTCCCCGAAGG - Intergenic
1067052006 10:43026948-43026970 GGCCCCTGCTTCCTCCCCGAGGG + Intergenic
1067082021 10:43217352-43217374 TGCTCCCTCTTCCCACGCCAGGG + Intronic
1069634284 10:69916064-69916086 TCCACCCTCTTCCTCCGTGATGG - Intronic
1069771412 10:70902891-70902913 TGCCACCTCTTCCTCTCTGATGG + Intergenic
1076510865 10:131012796-131012818 TGCCCCTGCTTCCTGCGGGAAGG - Intergenic
1076794082 10:132790428-132790450 TGCCCCCTCTTCCCAGGCTATGG + Intergenic
1078265835 11:9755930-9755952 TGCCCCCTCCTCCTCCTCATCGG + Intergenic
1083691991 11:64415027-64415049 TGCCCCATCTTCCTCCTCATGGG - Intergenic
1084358602 11:68655231-68655253 TGGCCTCTCCTCCTCCACGATGG + Intergenic
1088250674 11:107858705-107858727 GGCCGCCGCTCCCTCCGCGAGGG + Exonic
1091588056 12:1827304-1827326 TGCCCCCTTGTCCCCCGCGAAGG + Intronic
1095493063 12:42756524-42756546 TGGCCCCTCTTCTTCCTGGATGG - Intergenic
1099829345 12:87820661-87820683 GACCCCCTCTTCCTCTGCCACGG + Intergenic
1102788545 12:115624078-115624100 TGCCCCCTCCTCCTCCTCGCCGG - Intergenic
1103321900 12:120097015-120097037 TGCCCCCTCCTCCCCGGCCAAGG - Exonic
1105272949 13:18894829-18894851 TGCCTCCATTTCCTCCGCAAAGG + Intergenic
1108585361 13:51865947-51865969 GGCCCTCTCTTCCTCCCAGAGGG - Exonic
1110307517 13:74007029-74007051 TTCCTCCTCTTCCTCTGGGAGGG + Intronic
1111063847 13:83063856-83063878 TGCTCCCTCTTCCACCCCCAGGG + Intergenic
1112285113 13:98097062-98097084 TGCCCCCACTTCCTGGGAGATGG - Intergenic
1120406569 14:84099599-84099621 TGCCCCCCCTCCCTCCCGGACGG + Intergenic
1121896994 14:97657872-97657894 TGCCCCCTCATCCTCTGCACTGG - Intergenic
1122112245 14:99510628-99510650 TCCCCCCTCATCCTCCTCCAGGG + Exonic
1122299295 14:100722950-100722972 TGCCTGCTCTTCCTCCCCAAGGG - Intergenic
1122419869 14:101568807-101568829 TGTCCACTCTTCCTCCGCTCAGG - Intergenic
1123016325 14:105377315-105377337 TGCCTCCTCCTCCTCAGGGAGGG - Intronic
1128816268 15:70610987-70611009 TGCCCCCAGTTCCTCCACTATGG + Intergenic
1131016840 15:89064940-89064962 TGCCCTCTCATCCCCCGAGAGGG + Intergenic
1132633690 16:932252-932274 GGCCCTCTCATCCTCAGCGATGG + Intronic
1133050093 16:3112661-3112683 TGCCCCCTCTGCCTCCACCCCGG + Exonic
1136022820 16:27450788-27450810 GGCCCCGTCTTCCTCCCCAAAGG + Exonic
1136566916 16:31076230-31076252 TGCCCCCTCTTCCTAGGCCTTGG + Exonic
1137708144 16:50549049-50549071 TGCCCCCTCTTCCTGCCCCCCGG + Intronic
1140710330 16:77671636-77671658 TGTCCCCTCTTCCTTCCCTAAGG - Intergenic
1142318721 16:89367141-89367163 TGCCTGCTCTTCCTCACCGATGG - Intronic
1142610947 17:1109048-1109070 CGCCTCCTCTTCCTCCTCCATGG + Intronic
1143003651 17:3812576-3812598 TCCCTCCTCTTCCCCCTCGAAGG + Exonic
1143184332 17:5001203-5001225 TGCCCCCACTTTCTCCTAGACGG + Exonic
1147819283 17:43232082-43232104 TTCCCCCTTTTCCCCCGCGCCGG - Intergenic
1147819872 17:43235113-43235135 TTCCCCCTTTTCCCCCGCGCCGG - Intergenic
1147821184 17:43242511-43242533 TTCCCCCTTTTCCCCCGCGCCGG - Intergenic
1147825592 17:43267959-43267981 TTCCCCCTTTTCCCCCGCGCCGG - Intergenic
1147826723 17:43274426-43274448 TTCCCCCTTTTCCCCCGCGCCGG - Intergenic
1147827612 17:43279304-43279326 TTCCCCCTTTTCCCCCGCGCCGG - Intergenic
1147828719 17:43285465-43285487 TTCCCCCTTTTCCCCCGCGCCGG - Intergenic
1147830907 17:43297738-43297760 TTCCCCCTTTTCCCCCGCGCCGG - Intergenic
1147831606 17:43301367-43301389 TTCCCCCTTTTCCCCCGCGCCGG - Intergenic
1148693358 17:49545417-49545439 TGCCCCCTCTTCCTTCCCTGGGG - Intergenic
1152363109 17:79841427-79841449 CGACCCCTCTCCCTCCGCGGTGG - Intergenic
1154994733 18:21629105-21629127 GACCCCCTCTTCCTCTGCCACGG - Exonic
1159011757 18:63064628-63064650 AGCCCCCTCTTCTTCCCTGAGGG + Intergenic
1159548745 18:69872878-69872900 TGCCCTGTCTTCCTCCTCCAAGG - Intronic
1161060060 19:2210392-2210414 TGCCTCCTGTTCCTCCTGGAAGG - Exonic
1164105348 19:22105357-22105379 GGCCCCCACCTCCCCCGCGATGG - Intergenic
1166039274 19:40192030-40192052 CGCCCCCTCCTCCTCCTCCATGG - Exonic
1166541301 19:43607773-43607795 TTCCTCCTCTTCCTCCCCGAGGG + Exonic
1167041132 19:47023051-47023073 TCCCCCCTCTTCCCCTGGGACGG - Intronic
925044954 2:766123-766145 TGCCACCTCTTCCACCAAGAGGG + Intergenic
925298974 2:2796429-2796451 GGCACCCCCTTCCTCCGCCAGGG - Intergenic
926754863 2:16226660-16226682 TCCCCCCTCTTCCCCAGTGATGG + Intergenic
931690478 2:64831275-64831297 TGCCCTCTCTTCCTGCTCCAGGG + Intergenic
937077364 2:119116985-119117007 TGCCCCCTCGTCCTCCCTGCTGG - Intergenic
938583929 2:132670746-132670768 TGCCCCCTCTTCCTCCGCGAAGG + Intronic
941625511 2:167826399-167826421 TGCCTCCTCTTCCTCAGCTCTGG - Intergenic
944087755 2:195869203-195869225 TGGCCCCTCTTCTTCCTGGATGG - Intronic
946332426 2:219017979-219018001 TTCCCCATCTTCCTCCACCATGG + Intronic
947380794 2:229543638-229543660 TGTCTCCTCCTCCTCCCCGAAGG + Intronic
1172952049 20:38728623-38728645 TGCGCCCTAGTCCTCCGCGTTGG - Exonic
1174835397 20:53852082-53852104 TTCCCCTTCTTCCTCTGCGGGGG + Intergenic
1176086297 20:63297006-63297028 CGCCCCCTCTTCCTCTCAGATGG + Intronic
1176867412 21:14062016-14062038 TGCCCCCTCTTCCCGCACCATGG + Intergenic
1180614996 22:17121024-17121046 CAGCCCCTCTTCCTCCGCGGGGG - Exonic
1181963712 22:26642046-26642068 TGCCCCCTCTACCCCAGTGAAGG + Intergenic
1183235085 22:36610863-36610885 TGCCCACTCTTCCTAAGCGAGGG - Intronic
1183830721 22:40417247-40417269 TGCCCCCTATTCCTCCGGGTGGG + Intronic
1184037842 22:41926829-41926851 GCCCCCCGCTTCCTCCCCGAGGG - Intergenic
952957000 3:38563620-38563642 TGCCCCGTCTGCCCCGGCGATGG + Intronic
954224616 3:49173883-49173905 CCCCCCATCTTCCTCCCCGAGGG + Intronic
964491579 3:157241926-157241948 TGCCCCCTCTTCTTCTGAAAGGG + Intergenic
968763112 4:2452481-2452503 TGGCTCCTCTTCCTCCTCGAAGG + Intronic
969032692 4:4227061-4227083 TGCCCCTTCGTCCTCCGTCAAGG + Intergenic
969334137 4:6497020-6497042 TGCCCTCTCTTCCTGAGGGATGG + Intronic
970203009 4:13628010-13628032 TGGCCCCGCTTCATCCGCGACGG + Intergenic
973228886 4:47819457-47819479 TGTCCCCTCTTCCTCTAGGAAGG - Intronic
985547317 5:516165-516187 TGCCCCCTCTGCCCCAGGGATGG + Intronic
991645313 5:68795369-68795391 TGGCCCCTTTGCCTCGGCGAGGG + Intergenic
992610753 5:78506441-78506463 TGCCCCCTCTCCCTCAGCCCTGG - Intronic
998583501 5:143403827-143403849 TGCCCCCACGCCCTCCGCGCGGG + Intronic
999369879 5:151048221-151048243 TGCACCCTGAACCTCCGCGAGGG + Intronic
999854533 5:155579826-155579848 TGCCCCATCCTCCTCCTTGAGGG - Intergenic
1002211177 5:177600217-177600239 TGCGCCGCTTTCCTCCGCGAGGG - Exonic
1006416016 6:33904356-33904378 TGTCCCCTCTTTCTCCTCAAAGG - Intergenic
1007249963 6:40488782-40488804 TGCCTCCTCTGCCTCCTTGAGGG + Intronic
1010321711 6:74518077-74518099 TGCCCCCTCTTCCACCTTTAAGG - Intergenic
1013507591 6:110815337-110815359 TTCCTCCTCCTCCTCCGCGACGG + Intronic
1021268830 7:18559502-18559524 TACCCCCTCCTCCTCAGGGATGG - Intronic
1027270528 7:76516168-76516190 TGCCCCTTCTGCCTCCGAGGCGG + Intronic
1027806351 7:82829315-82829337 TGCCCCTGCTTACTCCCCGAAGG + Intronic
1028581484 7:92413773-92413795 TGACCCCTGTTCCTCCTGGATGG - Intergenic
1030521858 7:110607289-110607311 TGCTCCCTCTGCCTCAGGGAAGG + Intergenic
1031083183 7:117278007-117278029 AGCCCCCTCTTCCTCCCTGGGGG - Exonic
1032236740 7:130130984-130131006 TACTCCCTCTTCCTTCTCGATGG + Exonic
1034089216 7:148348543-148348565 TGTCACCTCGTCCTCCGTGAGGG - Intronic
1034516636 7:151585992-151586014 TACCCCAGCTTCCTCCGCCAGGG - Intronic
1038024436 8:23576193-23576215 TCCCCCCTCTCCCTCCACCATGG + Intergenic
1039397381 8:37238219-37238241 TGCCCCCGCTACCTTGGCGAGGG - Intergenic
1039889433 8:41674111-41674133 TGCCCCCTCAGCCTCCGCTCGGG + Intronic
1041375380 8:57206188-57206210 AGCCCCCTCTTCCCCGCCGAGGG - Intergenic
1041376141 8:57210567-57210589 AGCCCCCTCTTCCCCGCCGAGGG - Intergenic
1048694142 8:137005268-137005290 TGCCCCCTCTGCCTGCTAGATGG + Intergenic
1049738032 8:144220483-144220505 TGCTCCCTCTTCCTCCTACACGG + Intronic
1049775262 8:144401071-144401093 TGCCCCCTCTGCCCCCAGGACGG - Exonic
1050472386 9:6007440-6007462 CGCCACCTCCTCCTCCGCGGTGG + Exonic
1053138032 9:35664016-35664038 TGCTCCCTCTGCCTCTGCAACGG - Exonic
1053409486 9:37906336-37906358 TGCCTCCTCTCCCTCCTAGAAGG + Intronic
1058234711 9:102475275-102475297 AGCCCCCTCTACCTCAGCGAAGG + Intergenic
1058885676 9:109320166-109320188 TGCCGCGTCTTCCTGCTCGACGG - Exonic
1060980682 9:127789828-127789850 TGTCCCCTCTTCCACCACGCCGG - Exonic
1187229452 X:17406842-17406864 TTCTCCCTCTTCCTCTGCAATGG - Intronic
1190745060 X:53317642-53317664 TCTCCCCTCTTCCTCCACCAGGG + Intronic
1195078371 X:101348634-101348656 CTCCTCCTCTTCCTCCGCGGCGG - Exonic