ID: 938585501

View in Genome Browser
Species Human (GRCh38)
Location 2:132686409-132686431
Sequence GACAACAAGGGGCAGTCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938585501_938585513 16 Left 938585501 2:132686409-132686431 CCTGATGACTGCCCCTTGTTGTC No data
Right 938585513 2:132686448-132686470 GACCATTCTCATGGCATGGTGGG No data
938585501_938585509 7 Left 938585501 2:132686409-132686431 CCTGATGACTGCCCCTTGTTGTC No data
Right 938585509 2:132686439-132686461 CCCTGTGTGGACCATTCTCATGG No data
938585501_938585505 -6 Left 938585501 2:132686409-132686431 CCTGATGACTGCCCCTTGTTGTC No data
Right 938585505 2:132686426-132686448 GTTGTCCCTTCATCCCTGTGTGG No data
938585501_938585511 12 Left 938585501 2:132686409-132686431 CCTGATGACTGCCCCTTGTTGTC No data
Right 938585511 2:132686444-132686466 TGTGGACCATTCTCATGGCATGG No data
938585501_938585512 15 Left 938585501 2:132686409-132686431 CCTGATGACTGCCCCTTGTTGTC No data
Right 938585512 2:132686447-132686469 GGACCATTCTCATGGCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938585501 Original CRISPR GACAACAAGGGGCAGTCATC AGG (reversed) Intronic
No off target data available for this crispr