ID: 938590231

View in Genome Browser
Species Human (GRCh38)
Location 2:132728809-132728831
Sequence TGCCACCGGGACCCAGGTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 165}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938590231_938590244 22 Left 938590231 2:132728809-132728831 CCCTCACCTGGGTCCCGGTGGCA 0: 1
1: 0
2: 2
3: 11
4: 165
Right 938590244 2:132728854-132728876 GAAGCGGCTGGCTTGCCATTGGG 0: 1
1: 0
2: 0
3: 5
4: 66
938590231_938590237 6 Left 938590231 2:132728809-132728831 CCCTCACCTGGGTCCCGGTGGCA 0: 1
1: 0
2: 2
3: 11
4: 165
Right 938590237 2:132728838-132728860 TCACTCCCCCAGTCTGGAAGCGG 0: 1
1: 0
2: 0
3: 16
4: 176
938590231_938590243 21 Left 938590231 2:132728809-132728831 CCCTCACCTGGGTCCCGGTGGCA 0: 1
1: 0
2: 2
3: 11
4: 165
Right 938590243 2:132728853-132728875 GGAAGCGGCTGGCTTGCCATTGG 0: 1
1: 0
2: 0
3: 8
4: 90
938590231_938590238 10 Left 938590231 2:132728809-132728831 CCCTCACCTGGGTCCCGGTGGCA 0: 1
1: 0
2: 2
3: 11
4: 165
Right 938590238 2:132728842-132728864 TCCCCCAGTCTGGAAGCGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 161
938590231_938590236 0 Left 938590231 2:132728809-132728831 CCCTCACCTGGGTCCCGGTGGCA 0: 1
1: 0
2: 2
3: 11
4: 165
Right 938590236 2:132728832-132728854 GCAACTTCACTCCCCCAGTCTGG 0: 1
1: 0
2: 0
3: 14
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938590231 Original CRISPR TGCCACCGGGACCCAGGTGA GGG (reversed) Exonic
900100934 1:961760-961782 GGACACCGGGATCCGGGTGAGGG - Intronic
900340312 1:2185476-2185498 AGCCAGCGGGACACAGGTGGGGG + Intronic
900372465 1:2338047-2338069 TGCCCCGGGGCCCCATGTGAGGG - Intronic
900523441 1:3117045-3117067 TGCCCCCAGGACCCACGGGAAGG + Intronic
900931571 1:5741304-5741326 CTCCACCTGGAGCCAGGTGAGGG + Intergenic
902238997 1:15075851-15075873 TGGCACAGGGACCCAGGGGATGG + Intronic
902323823 1:15685059-15685081 TGTCGCCGGGACCCAGGCCATGG - Intronic
902536189 1:17120347-17120369 TCCCACTGGGTCCCAGGGGAAGG - Intergenic
902927816 1:19708600-19708622 TGCCAGCGGGAATCAGGTGAAGG + Intronic
905310812 1:37047587-37047609 TTCCTCCAGGACCCAGTTGATGG + Intergenic
906247973 1:44290378-44290400 TGCCACAGGGACACCTGTGAGGG + Intronic
906559963 1:46749082-46749104 TGCTGCTGGGACCAAGGTGAGGG - Intergenic
918181550 1:182089041-182089063 TGGCACCCAGACCCAGGTTATGG - Intergenic
921682011 1:218044743-218044765 TGGCACCTGGACCCAGCAGATGG + Intergenic
922042557 1:221910968-221910990 TCCCACAGGGACCTTGGTGATGG - Intergenic
1062920422 10:1274928-1274950 TGCGGCCGGGACACGGGTGAAGG + Intronic
1063857653 10:10272714-10272736 GGGCACAGGGACCCATGTGAAGG + Intergenic
1065777333 10:29132998-29133020 TGCCACCTAGCCCCAGGTGACGG - Intergenic
1069654229 10:70075875-70075897 TGCGAGGGGGACCCAGGGGAGGG - Intronic
1071049047 10:81423489-81423511 TGTTACAGGGATCCAGGTGAGGG + Intergenic
1075599801 10:123759146-123759168 TGAGACCGGGGCCCATGTGAGGG - Intronic
1075709190 10:124521606-124521628 TGCCACCTGGGCCCAGGACAAGG - Intronic
1077089053 11:770091-770113 TGCCCCCTGGCCCCAGGTTAGGG - Exonic
1079337183 11:19580211-19580233 TGTCACCGAAACCCAGATGAAGG + Intronic
1081967479 11:47178417-47178439 TGCCACCGGGGTTCGGGTGAGGG - Exonic
1083431103 11:62613836-62613858 GGTCACCGGGATCCAGGTAACGG - Exonic
1083491260 11:63016382-63016404 TGCCCCAGGGGCCCAGGAGATGG - Intergenic
1083846882 11:65340530-65340552 CGACACCGGGGTCCAGGTGAGGG + Exonic
1083948977 11:65943383-65943405 TTCCACTGGGCCCCAGGTGTGGG + Intergenic
1084956726 11:72695535-72695557 TGCCAGTGGGACCCAGGTGAAGG - Exonic
1085531355 11:77194120-77194142 TGCCAGAGGGATCCAGGAGAAGG + Intronic
1086123531 11:83326437-83326459 TGCCACCTGGGCCAAGGTGCAGG - Intergenic
1089480624 11:118801783-118801805 TGACACCTGGACCCATCTGAGGG - Intergenic
1089591210 11:119541875-119541897 TGCCTCCAGGACCCAGGATAGGG + Intergenic
1089836682 11:121376522-121376544 TGCCACCTGGCCCCAGATGCAGG + Intergenic
1090755285 11:129785032-129785054 GGTCACTGGGACCCAGATGATGG - Intergenic
1091139010 11:133219562-133219584 TGACAGTGGGACCCAGGGGATGG - Intronic
1091327473 11:134701800-134701822 GGCCGCCAGGACCCAGGGGAAGG - Intergenic
1091588128 12:1827615-1827637 AGGAACCGGGACCCAGGTGAGGG + Exonic
1092140101 12:6177982-6178004 TGCCACCTGGAGCCAGGGGAGGG + Intergenic
1093791455 12:23255183-23255205 TGGCACGGGGACCCTGATGAGGG - Intergenic
1096818385 12:54216021-54216043 TGCCACGGGAGCCCACGTGAGGG + Intergenic
1097643025 12:62205123-62205145 TGCAGGAGGGACCCAGGTGAAGG - Intronic
1102998179 12:117365386-117365408 TGCCACCTGGACACAGCTGCCGG - Intronic
1103595735 12:122023260-122023282 TCCCTCCGGGACCCCAGTGAAGG - Intronic
1108666356 13:52635915-52635937 TTCAACCGGGACCCAGGAGGTGG - Intergenic
1113512596 13:110867929-110867951 TGTCACCCGGTACCAGGTGAGGG - Intergenic
1113955518 13:114098316-114098338 GGCAACAGGGACCCAGGTGCGGG + Intronic
1119322188 14:73738834-73738856 TGCCCCAGGGAGCCAGGTGGCGG + Exonic
1119643787 14:76334346-76334368 TGACACCTGTTCCCAGGTGAAGG + Intronic
1121184723 14:91956644-91956666 TGCCACCAGAACCCAGGAGTGGG + Intergenic
1122406831 14:101505755-101505777 TGCCACCGGCACCCAGGAGAGGG + Intergenic
1124516029 15:30368022-30368044 TTCCACCTGGGCCCAGGTGAGGG + Intronic
1124726891 15:32162709-32162731 TTCCACCTGGGCCCAGGTGAGGG - Intronic
1125757320 15:42072386-42072408 TGCCCTCTGGCCCCAGGTGATGG - Exonic
1127473910 15:59314493-59314515 TGCCACCTGGTCACAGGAGAAGG + Intronic
1130044377 15:80432199-80432221 TGCCCCAGAGACGCAGGTGAAGG - Intronic
1132465116 16:73782-73804 TGCCACCCAGACCCAGAGGATGG - Intronic
1132763009 16:1520089-1520111 TGCCAGCGGGGCCCCGGGGAGGG - Intronic
1135766020 16:25178542-25178564 TGCCACCATGACCAAGATGAAGG - Intergenic
1136234616 16:28905936-28905958 AGCCACCGGGGCCCAGGCGTGGG - Intronic
1138808479 16:60120911-60120933 TGCCTCCTGATCCCAGGTGATGG - Intergenic
1139648987 16:68352337-68352359 TGGCACCTGGCCCCAGGTGCTGG - Exonic
1140587431 16:76309709-76309731 TGTGACAGGGACCCAGGTGGAGG + Intronic
1141410764 16:83831439-83831461 TGCATCCGGGAGCCAGGGGATGG + Intergenic
1142922988 17:3207463-3207485 TCCCCTCGGGACACAGGTGAAGG + Intergenic
1144623799 17:16834178-16834200 TGCCACCAGTCCTCAGGTGAGGG + Intergenic
1144834962 17:18151936-18151958 TGCACCTGGCACCCAGGTGAGGG + Exonic
1144841605 17:18189983-18190005 AGCCACCTGGACCCAGGGGCAGG - Intronic
1144882631 17:18438538-18438560 TGCCACCAGTCCTCAGGTGAGGG - Intergenic
1145149603 17:20505848-20505870 TGCCACCAGTCCTCAGGTGAGGG + Intergenic
1147887947 17:43697254-43697276 TGGAACCAGGACCCAGATGAGGG + Intergenic
1148201075 17:45750394-45750416 TGGAACTGGGACCAAGGTGAAGG - Intergenic
1148934498 17:51154022-51154044 TGTCACCGGGACCGATGTGGAGG + Intronic
1150507057 17:65709675-65709697 TTCCACCTGGAACCAGATGATGG - Intronic
1152109087 17:78347498-78347520 GGCCCCAGGGCCCCAGGTGAAGG + Intergenic
1152573643 17:81131008-81131030 TCCCTCCGGGGCCCAGGTGCTGG - Intronic
1156468330 18:37362019-37362041 GGACCCCAGGACCCAGGTGAAGG - Intronic
1160222068 18:76984965-76984987 TGCCACCAGGGCCCCGGGGAAGG + Intronic
1160734189 19:654355-654377 AGCCACCGCGCCCCCGGTGATGG - Intronic
1161156062 19:2732444-2732466 TCTCACCGGGACCCAGGTCCTGG + Intronic
1162127365 19:8506677-8506699 GGCCCCCGGGACCCTGGAGAGGG + Intergenic
1162293466 19:9796353-9796375 AGCCACCGGGAACCAGCAGATGG - Intergenic
1165065265 19:33224964-33224986 TGGCAGCAGGACCCAGGAGAGGG - Intronic
1165742988 19:38214574-38214596 TGCTACCGGTGCCCAGGTGGTGG + Intronic
1166541166 19:43607120-43607142 TGCCAGCAGGACCCAGGCTATGG + Intronic
1167524041 19:49972703-49972725 TGCCCCAGGGACCAAGGGGAGGG + Intergenic
1168414214 19:56158673-56158695 TGGCACCAGGACCCAGGACAAGG + Intronic
926158160 2:10469495-10469517 TGCCACCAGGAGCCAGGGGCTGG - Intergenic
927420025 2:22921019-22921041 AGACACCGGGACCTAGTTGAGGG + Intergenic
928198586 2:29232238-29232260 TGGCATCGGGGCCCAGCTGAAGG + Intronic
930335018 2:50034474-50034496 TGACACCGGGACCTAGTGGAGGG + Intronic
933992280 2:87642401-87642423 CCCCACCGGGACCCCTGTGAAGG - Intergenic
934653974 2:96107873-96107895 TTTCACCAGGACACAGGTGAGGG + Intergenic
936301570 2:111308438-111308460 CCCCACCGGGACCCCTGTGAAGG + Intergenic
937978574 2:127596996-127597018 TGGCTCAGGAACCCAGGTGAGGG - Intronic
938252504 2:129826911-129826933 TGACACCGGGACCTACATGAGGG + Intergenic
938590231 2:132728809-132728831 TGCCACCGGGACCCAGGTGAGGG - Exonic
940874358 2:158885018-158885040 TGATACCGGGACCAAGGTGGCGG - Intergenic
944454178 2:199876447-199876469 TGGTCCCTGGACCCAGGTGATGG + Intergenic
946366943 2:219254219-219254241 TGCCTCCAGGACGCAGGTGCAGG - Intronic
946662635 2:222018034-222018056 TGCTATGGGGACCTAGGTGAAGG + Intergenic
948762301 2:240199594-240199616 TGGCCCCTGGAGCCAGGTGAGGG - Intergenic
948886492 2:240887647-240887669 TGCCACTAGGACACAGGAGAGGG + Intronic
1169227607 20:3866055-3866077 AGCCACAGAGCCCCAGGTGAGGG - Exonic
1169746899 20:8952006-8952028 GGACACAGGGACCCAGGAGAGGG - Intronic
1170474432 20:16700949-16700971 GGTCACCAGGAGCCAGGTGAGGG - Intergenic
1171430598 20:25081413-25081435 TTCCACCCGGAACCAGGTGGTGG + Intronic
1171968836 20:31550445-31550467 TGCCAAGGGGACCCCAGTGAGGG - Intronic
1172770182 20:37377643-37377665 GGCCATGTGGACCCAGGTGATGG + Intronic
1172786799 20:37473851-37473873 TGCCACCAGGACCCAGGGACAGG + Intergenic
1173248403 20:41351837-41351859 TGTCACTGGGGCCCAGGTGCTGG - Exonic
1174790268 20:53471699-53471721 TGGCAGAGGGACCCAGGTGAAGG + Intronic
1179888901 21:44326095-44326117 TGCCCCAGGGAGCCAGGGGAGGG - Intronic
1179913981 21:44464609-44464631 TGCCACCGAGGGCCAGGCGAGGG - Intergenic
1179994106 21:44966102-44966124 TGCTACAGGGACCCAGGGCAGGG + Intronic
1182472412 22:30556623-30556645 TGCCAACGGGGCCCTGGTGGGGG - Intronic
1183070031 22:35389801-35389823 TGCTACCAGGTCCCAGCTGAAGG - Intronic
1183465411 22:37977905-37977927 GACCACCGGCACCCAGGAGAGGG - Exonic
1184727841 22:46356790-46356812 TGCCACAGGGAGCCAGCCGAGGG - Intronic
1184801845 22:46765865-46765887 TTCAACCGGGACCCAGGAGGTGG - Intronic
1184842252 22:47058863-47058885 GGCCCGCTGGACCCAGGTGAAGG + Intronic
950134021 3:10568008-10568030 TGACACCTGTACCCAGGTGAGGG + Intronic
953114945 3:39983574-39983596 TGCCACTGGATCCCAGGGGAGGG + Intronic
953881483 3:46693516-46693538 TGCCGCCGGGACCAAGGAGCTGG + Intronic
961131644 3:124473431-124473453 TACCACAGGGAAGCAGGTGAAGG - Intronic
968486996 4:867618-867640 TGCCATGGGGACCCTGGTGCTGG - Intronic
968491031 4:890547-890569 TGCCAGCGGGGCCCACGGGAGGG + Exonic
969871326 4:10106918-10106940 TGCCATCTCGACCCAGCTGATGG - Intronic
970165037 4:13227537-13227559 TGCAGGAGGGACCCAGGTGAGGG + Intergenic
970447970 4:16139841-16139863 TGCCAGCAGGCCCCAGGTGGGGG + Intergenic
972581914 4:40402775-40402797 TGCCTCAGGGACCCAGGTGTGGG + Intergenic
978282570 4:107035673-107035695 AGCCCCCGCGACCCAAGTGAGGG - Exonic
980089518 4:128428048-128428070 TGCCAGCAGGACCCAGGTGCTGG - Intergenic
984964253 4:185127395-185127417 TGCGACCAGGACCCAGTTGGAGG + Intergenic
994115042 5:96052237-96052259 TGCCAAAGGGGCCCACGTGATGG - Intergenic
997816936 5:137028175-137028197 TTCCCCAGGGACACAGGTGAAGG + Intronic
998348585 5:141485977-141485999 TACCACTGGGACCCAGGTCCGGG - Exonic
998398813 5:141836788-141836810 TGCCACCCATGCCCAGGTGAAGG - Intergenic
1000226087 5:159263345-159263367 TTCCACCGCGCTCCAGGTGAGGG + Exonic
1001928256 5:175655064-175655086 TCACTCTGGGACCCAGGTGATGG + Intergenic
1005958774 6:30682346-30682368 TGCCACTGGAGCCCAGGGGATGG - Intronic
1006460851 6:34156982-34157004 TGTCATCAGCACCCAGGTGAAGG - Intergenic
1007588542 6:43007555-43007577 AGCCACTGGGACACAGATGAAGG - Intronic
1014009779 6:116462258-116462280 CGCCACGGCCACCCAGGTGAGGG - Exonic
1017766794 6:157613550-157613572 TACCTCCGGGACCCTGGGGATGG + Intronic
1018899512 6:168044154-168044176 ACCCTCCCGGACCCAGGTGAGGG + Intronic
1018899547 6:168044277-168044299 ACCCTCCCGGACCCAGGTGAGGG + Intronic
1018899571 6:168044360-168044382 ACCCTCCCGGACCCAGGTGAGGG + Intronic
1018899610 6:168044489-168044511 ACCCTCCCGGACCCAGGTGAGGG + Intronic
1019504921 7:1385968-1385990 TGCCGCAGGGAGCCAGGAGAGGG + Intergenic
1019551031 7:1602610-1602632 TGCCCCCGGAGCCCAGGTGCGGG - Intergenic
1020116924 7:5481351-5481373 TGCCACCGGGGCCCCGTGGATGG - Exonic
1024666407 7:51551272-51551294 TGCCACAGGCACCCAGCTGGTGG + Intergenic
1031483433 7:122303935-122303957 TGCTACCTGAACCGAGGTGACGG - Exonic
1033132004 7:138752664-138752686 TGCCACCGGGAACCAGATCTCGG + Exonic
1034261949 7:149762776-149762798 TGAGACCTGGACACAGGTGAGGG - Intergenic
1035822770 8:2612242-2612264 GGCCACAGGGACACAGATGAGGG - Intergenic
1035974195 8:4288604-4288626 TGCCACTGGGTTCAAGGTGAAGG + Intronic
1037200746 8:16249660-16249682 TGCCACCGGGCCTGAGGGGAGGG - Intronic
1037630258 8:20649385-20649407 GGCCACCTGCACCCAAGTGAGGG - Intergenic
1037649493 8:20823648-20823670 AGCCACCGTGACCTGGGTGAGGG + Intergenic
1038400982 8:27284374-27284396 TGACAACGGGCCCCTGGTGAGGG + Intergenic
1040299430 8:46180288-46180310 GGCCACAGGGACCCAGGGGGAGG - Intergenic
1044835044 8:96287588-96287610 AGCCACCGTGACCCAGGGCATGG - Intronic
1044999873 8:97869606-97869628 GGCCACCGCGACCCAGGGAAAGG + Intronic
1047884995 8:129240124-129240146 TGACACCAGGACCCAGCAGAAGG - Intergenic
1047919360 8:129618094-129618116 TGTCAGAGGGACCCAGGGGAAGG + Intergenic
1049742348 8:144247222-144247244 TGCCACCTGTACCCAGAGGAGGG - Intronic
1055436466 9:76296828-76296850 TGCCACCAAGACCCAGGAGGAGG + Exonic
1056692418 9:88819164-88819186 TGCCAGCGGCACCAAGGTTAAGG + Intergenic
1059983334 9:119797340-119797362 AGTCACTGGGACCCAGGTTAGGG - Intergenic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1060724316 9:125997104-125997126 TGCCAGAGGGACCCAGAGGAGGG - Intergenic
1062278805 9:135742958-135742980 TGCCTCTGGGTCCCAGGTGCTGG + Intronic
1062614667 9:137390977-137390999 TGCCTCCAGGACCCTGGGGACGG - Intronic
1185469539 X:374180-374202 GGCCTCGGGGACCCAGGCGAAGG + Intronic
1187392872 X:18897196-18897218 TCCCACGGGGACCCTGTTGATGG + Exonic
1199283462 X:146029853-146029875 TGCCACTGGGATCCATGTGTGGG - Intergenic