ID: 938590838

View in Genome Browser
Species Human (GRCh38)
Location 2:132734822-132734844
Sequence TGCGGGGAATCAGTATAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938590838_938590842 2 Left 938590838 2:132734822-132734844 CCAAGCTATACTGATTCCCCGCA No data
Right 938590842 2:132734847-132734869 AGCACAAGTAAACCCCAAAGTGG No data
938590838_938590843 3 Left 938590838 2:132734822-132734844 CCAAGCTATACTGATTCCCCGCA No data
Right 938590843 2:132734848-132734870 GCACAAGTAAACCCCAAAGTGGG No data
938590838_938590847 29 Left 938590838 2:132734822-132734844 CCAAGCTATACTGATTCCCCGCA No data
Right 938590847 2:132734874-132734896 TGCTCAGTTCATAGCCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938590838 Original CRISPR TGCGGGGAATCAGTATAGCT TGG (reversed) Intronic