ID: 938590839

View in Genome Browser
Species Human (GRCh38)
Location 2:132734838-132734860
Sequence GGTTTACTTGTGCTTCTGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938590839_938590847 13 Left 938590839 2:132734838-132734860 CCCCGCAGAAGCACAAGTAAACC No data
Right 938590847 2:132734874-132734896 TGCTCAGTTCATAGCCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938590839 Original CRISPR GGTTTACTTGTGCTTCTGCG GGG (reversed) Intronic