ID: 938590840

View in Genome Browser
Species Human (GRCh38)
Location 2:132734839-132734861
Sequence GGGTTTACTTGTGCTTCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938590840_938590847 12 Left 938590840 2:132734839-132734861 CCCGCAGAAGCACAAGTAAACCC No data
Right 938590847 2:132734874-132734896 TGCTCAGTTCATAGCCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938590840 Original CRISPR GGGTTTACTTGTGCTTCTGC GGG (reversed) Intronic