ID: 938590844

View in Genome Browser
Species Human (GRCh38)
Location 2:132734859-132734881
Sequence ACTGAGCAGAGCCCACTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938590844_938590847 -8 Left 938590844 2:132734859-132734881 CCCCAAAGTGGGCTCTGCTCAGT No data
Right 938590847 2:132734874-132734896 TGCTCAGTTCATAGCCATTCAGG No data
938590844_938590850 23 Left 938590844 2:132734859-132734881 CCCCAAAGTGGGCTCTGCTCAGT No data
Right 938590850 2:132734905-132734927 TGAGCAGAAGCCTCACAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938590844 Original CRISPR ACTGAGCAGAGCCCACTTTG GGG (reversed) Intronic