ID: 938590845

View in Genome Browser
Species Human (GRCh38)
Location 2:132734860-132734882
Sequence AACTGAGCAGAGCCCACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938590845_938590847 -9 Left 938590845 2:132734860-132734882 CCCAAAGTGGGCTCTGCTCAGTT No data
Right 938590847 2:132734874-132734896 TGCTCAGTTCATAGCCATTCAGG No data
938590845_938590851 30 Left 938590845 2:132734860-132734882 CCCAAAGTGGGCTCTGCTCAGTT No data
Right 938590851 2:132734913-132734935 AGCCTCACAGCATGGCCCCATGG No data
938590845_938590850 22 Left 938590845 2:132734860-132734882 CCCAAAGTGGGCTCTGCTCAGTT No data
Right 938590850 2:132734905-132734927 TGAGCAGAAGCCTCACAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938590845 Original CRISPR AACTGAGCAGAGCCCACTTT GGG (reversed) Intronic