ID: 938590846

View in Genome Browser
Species Human (GRCh38)
Location 2:132734861-132734883
Sequence GAACTGAGCAGAGCCCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938590846_938590850 21 Left 938590846 2:132734861-132734883 CCAAAGTGGGCTCTGCTCAGTTC No data
Right 938590850 2:132734905-132734927 TGAGCAGAAGCCTCACAGCATGG No data
938590846_938590847 -10 Left 938590846 2:132734861-132734883 CCAAAGTGGGCTCTGCTCAGTTC No data
Right 938590847 2:132734874-132734896 TGCTCAGTTCATAGCCATTCAGG No data
938590846_938590851 29 Left 938590846 2:132734861-132734883 CCAAAGTGGGCTCTGCTCAGTTC No data
Right 938590851 2:132734913-132734935 AGCCTCACAGCATGGCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938590846 Original CRISPR GAACTGAGCAGAGCCCACTT TGG (reversed) Intronic
No off target data available for this crispr