ID: 938590847

View in Genome Browser
Species Human (GRCh38)
Location 2:132734874-132734896
Sequence TGCTCAGTTCATAGCCATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938590846_938590847 -10 Left 938590846 2:132734861-132734883 CCAAAGTGGGCTCTGCTCAGTTC No data
Right 938590847 2:132734874-132734896 TGCTCAGTTCATAGCCATTCAGG No data
938590838_938590847 29 Left 938590838 2:132734822-132734844 CCAAGCTATACTGATTCCCCGCA No data
Right 938590847 2:132734874-132734896 TGCTCAGTTCATAGCCATTCAGG No data
938590840_938590847 12 Left 938590840 2:132734839-132734861 CCCGCAGAAGCACAAGTAAACCC No data
Right 938590847 2:132734874-132734896 TGCTCAGTTCATAGCCATTCAGG No data
938590839_938590847 13 Left 938590839 2:132734838-132734860 CCCCGCAGAAGCACAAGTAAACC No data
Right 938590847 2:132734874-132734896 TGCTCAGTTCATAGCCATTCAGG No data
938590844_938590847 -8 Left 938590844 2:132734859-132734881 CCCCAAAGTGGGCTCTGCTCAGT No data
Right 938590847 2:132734874-132734896 TGCTCAGTTCATAGCCATTCAGG No data
938590841_938590847 11 Left 938590841 2:132734840-132734862 CCGCAGAAGCACAAGTAAACCCC No data
Right 938590847 2:132734874-132734896 TGCTCAGTTCATAGCCATTCAGG No data
938590845_938590847 -9 Left 938590845 2:132734860-132734882 CCCAAAGTGGGCTCTGCTCAGTT No data
Right 938590847 2:132734874-132734896 TGCTCAGTTCATAGCCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938590847 Original CRISPR TGCTCAGTTCATAGCCATTC AGG Intronic