ID: 938590848

View in Genome Browser
Species Human (GRCh38)
Location 2:132734888-132734910
Sequence TGCTCACGTGGCTGCCTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938590848_938590850 -6 Left 938590848 2:132734888-132734910 CCATTCAGGCAGCCACGTGAGCA No data
Right 938590850 2:132734905-132734927 TGAGCAGAAGCCTCACAGCATGG No data
938590848_938590854 15 Left 938590848 2:132734888-132734910 CCATTCAGGCAGCCACGTGAGCA No data
Right 938590854 2:132734926-132734948 GGCCCCATGGCTTCCAGGCAAGG No data
938590848_938590851 2 Left 938590848 2:132734888-132734910 CCATTCAGGCAGCCACGTGAGCA No data
Right 938590851 2:132734913-132734935 AGCCTCACAGCATGGCCCCATGG No data
938590848_938590853 10 Left 938590848 2:132734888-132734910 CCATTCAGGCAGCCACGTGAGCA No data
Right 938590853 2:132734921-132734943 AGCATGGCCCCATGGCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938590848 Original CRISPR TGCTCACGTGGCTGCCTGAA TGG (reversed) Intronic