ID: 938590849

View in Genome Browser
Species Human (GRCh38)
Location 2:132734900-132734922
Sequence CTGTGAGGCTTCTGCTCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938590849_938590853 -2 Left 938590849 2:132734900-132734922 CCACGTGAGCAGAAGCCTCACAG No data
Right 938590853 2:132734921-132734943 AGCATGGCCCCATGGCTTCCAGG No data
938590849_938590854 3 Left 938590849 2:132734900-132734922 CCACGTGAGCAGAAGCCTCACAG No data
Right 938590854 2:132734926-132734948 GGCCCCATGGCTTCCAGGCAAGG No data
938590849_938590851 -10 Left 938590849 2:132734900-132734922 CCACGTGAGCAGAAGCCTCACAG No data
Right 938590851 2:132734913-132734935 AGCCTCACAGCATGGCCCCATGG No data
938590849_938590860 28 Left 938590849 2:132734900-132734922 CCACGTGAGCAGAAGCCTCACAG No data
Right 938590860 2:132734951-132734973 CCCAGCTTTTCCTCTGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938590849 Original CRISPR CTGTGAGGCTTCTGCTCACG TGG (reversed) Intronic