ID: 938590850

View in Genome Browser
Species Human (GRCh38)
Location 2:132734905-132734927
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938590846_938590850 21 Left 938590846 2:132734861-132734883 CCAAAGTGGGCTCTGCTCAGTTC No data
Right 938590850 2:132734905-132734927 TGAGCAGAAGCCTCACAGCATGG No data
938590848_938590850 -6 Left 938590848 2:132734888-132734910 CCATTCAGGCAGCCACGTGAGCA No data
Right 938590850 2:132734905-132734927 TGAGCAGAAGCCTCACAGCATGG No data
938590844_938590850 23 Left 938590844 2:132734859-132734881 CCCCAAAGTGGGCTCTGCTCAGT No data
Right 938590850 2:132734905-132734927 TGAGCAGAAGCCTCACAGCATGG No data
938590845_938590850 22 Left 938590845 2:132734860-132734882 CCCAAAGTGGGCTCTGCTCAGTT No data
Right 938590850 2:132734905-132734927 TGAGCAGAAGCCTCACAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type