ID: 938590851

View in Genome Browser
Species Human (GRCh38)
Location 2:132734913-132734935
Sequence AGCCTCACAGCATGGCCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938590845_938590851 30 Left 938590845 2:132734860-132734882 CCCAAAGTGGGCTCTGCTCAGTT No data
Right 938590851 2:132734913-132734935 AGCCTCACAGCATGGCCCCATGG No data
938590848_938590851 2 Left 938590848 2:132734888-132734910 CCATTCAGGCAGCCACGTGAGCA No data
Right 938590851 2:132734913-132734935 AGCCTCACAGCATGGCCCCATGG No data
938590846_938590851 29 Left 938590846 2:132734861-132734883 CCAAAGTGGGCTCTGCTCAGTTC No data
Right 938590851 2:132734913-132734935 AGCCTCACAGCATGGCCCCATGG No data
938590849_938590851 -10 Left 938590849 2:132734900-132734922 CCACGTGAGCAGAAGCCTCACAG No data
Right 938590851 2:132734913-132734935 AGCCTCACAGCATGGCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938590851 Original CRISPR AGCCTCACAGCATGGCCCCA TGG Intronic