ID: 938590854

View in Genome Browser
Species Human (GRCh38)
Location 2:132734926-132734948
Sequence GGCCCCATGGCTTCCAGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938590849_938590854 3 Left 938590849 2:132734900-132734922 CCACGTGAGCAGAAGCCTCACAG No data
Right 938590854 2:132734926-132734948 GGCCCCATGGCTTCCAGGCAAGG No data
938590848_938590854 15 Left 938590848 2:132734888-132734910 CCATTCAGGCAGCCACGTGAGCA No data
Right 938590854 2:132734926-132734948 GGCCCCATGGCTTCCAGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938590854 Original CRISPR GGCCCCATGGCTTCCAGGCA AGG Intronic