ID: 938590860

View in Genome Browser
Species Human (GRCh38)
Location 2:132734951-132734973
Sequence CCCAGCTTTTCCTCTGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938590857_938590860 -2 Left 938590857 2:132734930-132734952 CCATGGCTTCCAGGCAAGGTGCC No data
Right 938590860 2:132734951-132734973 CCCAGCTTTTCCTCTGAAATTGG No data
938590855_938590860 0 Left 938590855 2:132734928-132734950 CCCCATGGCTTCCAGGCAAGGTG No data
Right 938590860 2:132734951-132734973 CCCAGCTTTTCCTCTGAAATTGG No data
938590856_938590860 -1 Left 938590856 2:132734929-132734951 CCCATGGCTTCCAGGCAAGGTGC No data
Right 938590860 2:132734951-132734973 CCCAGCTTTTCCTCTGAAATTGG No data
938590852_938590860 13 Left 938590852 2:132734915-132734937 CCTCACAGCATGGCCCCATGGCT No data
Right 938590860 2:132734951-132734973 CCCAGCTTTTCCTCTGAAATTGG No data
938590849_938590860 28 Left 938590849 2:132734900-132734922 CCACGTGAGCAGAAGCCTCACAG No data
Right 938590860 2:132734951-132734973 CCCAGCTTTTCCTCTGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938590860 Original CRISPR CCCAGCTTTTCCTCTGAAAT TGG Intronic