ID: 938591215 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:132737883-132737905 |
| Sequence | CTGTAGAATAAGAGCAATCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 938591215_938591217 | -1 | Left | 938591215 | 2:132737883-132737905 | CCATGATTGCTCTTATTCTACAG | No data | ||
| Right | 938591217 | 2:132737905-132737927 | GAATGGTAATTATACTTCCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 938591215 | Original CRISPR | CTGTAGAATAAGAGCAATCA TGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||