ID: 938591215

View in Genome Browser
Species Human (GRCh38)
Location 2:132737883-132737905
Sequence CTGTAGAATAAGAGCAATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938591215_938591217 -1 Left 938591215 2:132737883-132737905 CCATGATTGCTCTTATTCTACAG No data
Right 938591217 2:132737905-132737927 GAATGGTAATTATACTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938591215 Original CRISPR CTGTAGAATAAGAGCAATCA TGG (reversed) Intronic
No off target data available for this crispr