ID: 938592719

View in Genome Browser
Species Human (GRCh38)
Location 2:132755072-132755094
Sequence AGTGAGTCAGTTTCATTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938592719_938592726 30 Left 938592719 2:132755072-132755094 CCAGAAAATGAAACTGACTCACT No data
Right 938592726 2:132755125-132755147 ATTAGCTCCTTCTTACTGGCTGG No data
938592719_938592723 26 Left 938592719 2:132755072-132755094 CCAGAAAATGAAACTGACTCACT No data
Right 938592723 2:132755121-132755143 TCCCATTAGCTCCTTCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938592719 Original CRISPR AGTGAGTCAGTTTCATTTTC TGG (reversed) Intronic
No off target data available for this crispr