ID: 938592721

View in Genome Browser
Species Human (GRCh38)
Location 2:132755095-132755117
Sequence ATGCTAGCTGCTCCACAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938592721_938592723 3 Left 938592721 2:132755095-132755117 CCTACCTGTGGAGCAGCTAGCAT No data
Right 938592723 2:132755121-132755143 TCCCATTAGCTCCTTCTTACTGG No data
938592721_938592728 21 Left 938592721 2:132755095-132755117 CCTACCTGTGGAGCAGCTAGCAT No data
Right 938592728 2:132755139-132755161 ACTGGCTGGAACCTAACTATTGG No data
938592721_938592729 22 Left 938592721 2:132755095-132755117 CCTACCTGTGGAGCAGCTAGCAT No data
Right 938592729 2:132755140-132755162 CTGGCTGGAACCTAACTATTGGG No data
938592721_938592726 7 Left 938592721 2:132755095-132755117 CCTACCTGTGGAGCAGCTAGCAT No data
Right 938592726 2:132755125-132755147 ATTAGCTCCTTCTTACTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938592721 Original CRISPR ATGCTAGCTGCTCCACAGGT AGG (reversed) Intronic
No off target data available for this crispr