ID: 938592722

View in Genome Browser
Species Human (GRCh38)
Location 2:132755099-132755121
Sequence AAAAATGCTAGCTGCTCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938592722_938592723 -1 Left 938592722 2:132755099-132755121 CCTGTGGAGCAGCTAGCATTTTT No data
Right 938592723 2:132755121-132755143 TCCCATTAGCTCCTTCTTACTGG No data
938592722_938592728 17 Left 938592722 2:132755099-132755121 CCTGTGGAGCAGCTAGCATTTTT No data
Right 938592728 2:132755139-132755161 ACTGGCTGGAACCTAACTATTGG No data
938592722_938592726 3 Left 938592722 2:132755099-132755121 CCTGTGGAGCAGCTAGCATTTTT No data
Right 938592726 2:132755125-132755147 ATTAGCTCCTTCTTACTGGCTGG No data
938592722_938592731 30 Left 938592722 2:132755099-132755121 CCTGTGGAGCAGCTAGCATTTTT No data
Right 938592731 2:132755152-132755174 TAACTATTGGGCAAAGCCCCAGG No data
938592722_938592729 18 Left 938592722 2:132755099-132755121 CCTGTGGAGCAGCTAGCATTTTT No data
Right 938592729 2:132755140-132755162 CTGGCTGGAACCTAACTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938592722 Original CRISPR AAAAATGCTAGCTGCTCCAC AGG (reversed) Intronic