ID: 938592723

View in Genome Browser
Species Human (GRCh38)
Location 2:132755121-132755143
Sequence TCCCATTAGCTCCTTCTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938592721_938592723 3 Left 938592721 2:132755095-132755117 CCTACCTGTGGAGCAGCTAGCAT No data
Right 938592723 2:132755121-132755143 TCCCATTAGCTCCTTCTTACTGG No data
938592719_938592723 26 Left 938592719 2:132755072-132755094 CCAGAAAATGAAACTGACTCACT No data
Right 938592723 2:132755121-132755143 TCCCATTAGCTCCTTCTTACTGG No data
938592722_938592723 -1 Left 938592722 2:132755099-132755121 CCTGTGGAGCAGCTAGCATTTTT No data
Right 938592723 2:132755121-132755143 TCCCATTAGCTCCTTCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938592723 Original CRISPR TCCCATTAGCTCCTTCTTAC TGG Intronic
No off target data available for this crispr