ID: 938592725

View in Genome Browser
Species Human (GRCh38)
Location 2:132755123-132755145
Sequence AGCCAGTAAGAAGGAGCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938592725_938592735 23 Left 938592725 2:132755123-132755145 CCATTAGCTCCTTCTTACTGGCT No data
Right 938592735 2:132755169-132755191 CCCAGGCCATGAGGACAATCTGG No data
938592725_938592729 -6 Left 938592725 2:132755123-132755145 CCATTAGCTCCTTCTTACTGGCT No data
Right 938592729 2:132755140-132755162 CTGGCTGGAACCTAACTATTGGG No data
938592725_938592731 6 Left 938592725 2:132755123-132755145 CCATTAGCTCCTTCTTACTGGCT No data
Right 938592731 2:132755152-132755174 TAACTATTGGGCAAAGCCCCAGG No data
938592725_938592728 -7 Left 938592725 2:132755123-132755145 CCATTAGCTCCTTCTTACTGGCT No data
Right 938592728 2:132755139-132755161 ACTGGCTGGAACCTAACTATTGG No data
938592725_938592732 14 Left 938592725 2:132755123-132755145 CCATTAGCTCCTTCTTACTGGCT No data
Right 938592732 2:132755160-132755182 GGGCAAAGCCCCAGGCCATGAGG No data
938592725_938592737 24 Left 938592725 2:132755123-132755145 CCATTAGCTCCTTCTTACTGGCT No data
Right 938592737 2:132755170-132755192 CCAGGCCATGAGGACAATCTGGG No data
938592725_938592738 27 Left 938592725 2:132755123-132755145 CCATTAGCTCCTTCTTACTGGCT No data
Right 938592738 2:132755173-132755195 GGCCATGAGGACAATCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938592725 Original CRISPR AGCCAGTAAGAAGGAGCTAA TGG (reversed) Intronic