ID: 938592727

View in Genome Browser
Species Human (GRCh38)
Location 2:132755132-132755154
Sequence TTAGGTTCCAGCCAGTAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938592727_938592731 -3 Left 938592727 2:132755132-132755154 CCTTCTTACTGGCTGGAACCTAA No data
Right 938592731 2:132755152-132755174 TAACTATTGGGCAAAGCCCCAGG No data
938592727_938592732 5 Left 938592727 2:132755132-132755154 CCTTCTTACTGGCTGGAACCTAA No data
Right 938592732 2:132755160-132755182 GGGCAAAGCCCCAGGCCATGAGG No data
938592727_938592738 18 Left 938592727 2:132755132-132755154 CCTTCTTACTGGCTGGAACCTAA No data
Right 938592738 2:132755173-132755195 GGCCATGAGGACAATCTGGGAGG No data
938592727_938592737 15 Left 938592727 2:132755132-132755154 CCTTCTTACTGGCTGGAACCTAA No data
Right 938592737 2:132755170-132755192 CCAGGCCATGAGGACAATCTGGG No data
938592727_938592740 24 Left 938592727 2:132755132-132755154 CCTTCTTACTGGCTGGAACCTAA No data
Right 938592740 2:132755179-132755201 GAGGACAATCTGGGAGGAAGAGG No data
938592727_938592735 14 Left 938592727 2:132755132-132755154 CCTTCTTACTGGCTGGAACCTAA No data
Right 938592735 2:132755169-132755191 CCCAGGCCATGAGGACAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938592727 Original CRISPR TTAGGTTCCAGCCAGTAAGA AGG (reversed) Intronic