ID: 938592728

View in Genome Browser
Species Human (GRCh38)
Location 2:132755139-132755161
Sequence ACTGGCTGGAACCTAACTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938592721_938592728 21 Left 938592721 2:132755095-132755117 CCTACCTGTGGAGCAGCTAGCAT No data
Right 938592728 2:132755139-132755161 ACTGGCTGGAACCTAACTATTGG No data
938592724_938592728 -6 Left 938592724 2:132755122-132755144 CCCATTAGCTCCTTCTTACTGGC No data
Right 938592728 2:132755139-132755161 ACTGGCTGGAACCTAACTATTGG No data
938592725_938592728 -7 Left 938592725 2:132755123-132755145 CCATTAGCTCCTTCTTACTGGCT No data
Right 938592728 2:132755139-132755161 ACTGGCTGGAACCTAACTATTGG No data
938592722_938592728 17 Left 938592722 2:132755099-132755121 CCTGTGGAGCAGCTAGCATTTTT No data
Right 938592728 2:132755139-132755161 ACTGGCTGGAACCTAACTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938592728 Original CRISPR ACTGGCTGGAACCTAACTAT TGG Intronic
No off target data available for this crispr