ID: 938592729

View in Genome Browser
Species Human (GRCh38)
Location 2:132755140-132755162
Sequence CTGGCTGGAACCTAACTATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938592722_938592729 18 Left 938592722 2:132755099-132755121 CCTGTGGAGCAGCTAGCATTTTT No data
Right 938592729 2:132755140-132755162 CTGGCTGGAACCTAACTATTGGG No data
938592721_938592729 22 Left 938592721 2:132755095-132755117 CCTACCTGTGGAGCAGCTAGCAT No data
Right 938592729 2:132755140-132755162 CTGGCTGGAACCTAACTATTGGG No data
938592725_938592729 -6 Left 938592725 2:132755123-132755145 CCATTAGCTCCTTCTTACTGGCT No data
Right 938592729 2:132755140-132755162 CTGGCTGGAACCTAACTATTGGG No data
938592724_938592729 -5 Left 938592724 2:132755122-132755144 CCCATTAGCTCCTTCTTACTGGC No data
Right 938592729 2:132755140-132755162 CTGGCTGGAACCTAACTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938592729 Original CRISPR CTGGCTGGAACCTAACTATT GGG Intronic