ID: 938592731

View in Genome Browser
Species Human (GRCh38)
Location 2:132755152-132755174
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938592724_938592731 7 Left 938592724 2:132755122-132755144 CCCATTAGCTCCTTCTTACTGGC No data
Right 938592731 2:132755152-132755174 TAACTATTGGGCAAAGCCCCAGG No data
938592722_938592731 30 Left 938592722 2:132755099-132755121 CCTGTGGAGCAGCTAGCATTTTT No data
Right 938592731 2:132755152-132755174 TAACTATTGGGCAAAGCCCCAGG No data
938592725_938592731 6 Left 938592725 2:132755123-132755145 CCATTAGCTCCTTCTTACTGGCT No data
Right 938592731 2:132755152-132755174 TAACTATTGGGCAAAGCCCCAGG No data
938592727_938592731 -3 Left 938592727 2:132755132-132755154 CCTTCTTACTGGCTGGAACCTAA No data
Right 938592731 2:132755152-132755174 TAACTATTGGGCAAAGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr