ID: 938592735

View in Genome Browser
Species Human (GRCh38)
Location 2:132755169-132755191
Sequence CCCAGGCCATGAGGACAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938592724_938592735 24 Left 938592724 2:132755122-132755144 CCCATTAGCTCCTTCTTACTGGC No data
Right 938592735 2:132755169-132755191 CCCAGGCCATGAGGACAATCTGG No data
938592727_938592735 14 Left 938592727 2:132755132-132755154 CCTTCTTACTGGCTGGAACCTAA No data
Right 938592735 2:132755169-132755191 CCCAGGCCATGAGGACAATCTGG No data
938592730_938592735 -4 Left 938592730 2:132755150-132755172 CCTAACTATTGGGCAAAGCCCCA No data
Right 938592735 2:132755169-132755191 CCCAGGCCATGAGGACAATCTGG No data
938592725_938592735 23 Left 938592725 2:132755123-132755145 CCATTAGCTCCTTCTTACTGGCT No data
Right 938592735 2:132755169-132755191 CCCAGGCCATGAGGACAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938592735 Original CRISPR CCCAGGCCATGAGGACAATC TGG Intronic