ID: 938592738

View in Genome Browser
Species Human (GRCh38)
Location 2:132755173-132755195
Sequence GGCCATGAGGACAATCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938592725_938592738 27 Left 938592725 2:132755123-132755145 CCATTAGCTCCTTCTTACTGGCT No data
Right 938592738 2:132755173-132755195 GGCCATGAGGACAATCTGGGAGG No data
938592730_938592738 0 Left 938592730 2:132755150-132755172 CCTAACTATTGGGCAAAGCCCCA No data
Right 938592738 2:132755173-132755195 GGCCATGAGGACAATCTGGGAGG No data
938592724_938592738 28 Left 938592724 2:132755122-132755144 CCCATTAGCTCCTTCTTACTGGC No data
Right 938592738 2:132755173-132755195 GGCCATGAGGACAATCTGGGAGG No data
938592727_938592738 18 Left 938592727 2:132755132-132755154 CCTTCTTACTGGCTGGAACCTAA No data
Right 938592738 2:132755173-132755195 GGCCATGAGGACAATCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938592738 Original CRISPR GGCCATGAGGACAATCTGGG AGG Intronic