ID: 938593308

View in Genome Browser
Species Human (GRCh38)
Location 2:132761373-132761395
Sequence GACCAGTGGTCCCAGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938593308_938593315 19 Left 938593308 2:132761373-132761395 CCAGCACACTGGGACCACTGGTC No data
Right 938593315 2:132761415-132761437 AGAGACTAGCGCATGCCCCATGG No data
938593308_938593317 30 Left 938593308 2:132761373-132761395 CCAGCACACTGGGACCACTGGTC No data
Right 938593317 2:132761426-132761448 CATGCCCCATGGGCAAATGCTGG No data
938593308_938593316 20 Left 938593308 2:132761373-132761395 CCAGCACACTGGGACCACTGGTC No data
Right 938593316 2:132761416-132761438 GAGACTAGCGCATGCCCCATGGG No data
938593308_938593310 -9 Left 938593308 2:132761373-132761395 CCAGCACACTGGGACCACTGGTC No data
Right 938593310 2:132761387-132761409 CCACTGGTCACCCTAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938593308 Original CRISPR GACCAGTGGTCCCAGTGTGC TGG (reversed) Intronic
No off target data available for this crispr