ID: 938593843

View in Genome Browser
Species Human (GRCh38)
Location 2:132766641-132766663
Sequence TTTGATAAGCACCTAGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938593841_938593843 -7 Left 938593841 2:132766625-132766647 CCAGAGTTCCTTTCATTTTGATA No data
Right 938593843 2:132766641-132766663 TTTGATAAGCACCTAGATCTTGG No data
938593840_938593843 -6 Left 938593840 2:132766624-132766646 CCCAGAGTTCCTTTCATTTTGAT No data
Right 938593843 2:132766641-132766663 TTTGATAAGCACCTAGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938593843 Original CRISPR TTTGATAAGCACCTAGATCT TGG Intronic
No off target data available for this crispr